Mutagenetix > Incidental Mutations

Incidental Mutation 'R7040:Sorbs1'

547032

Institutional Source

Beutler Lab

Gene Symbol

Sorbs1

Ensembl Gene

ENSMUSG00000025006

Gene Name

sorbin and SH3 domain containing 1

Synonyms

9530001P15Rik, 2310065E01Rik, Ponsin, Sh3d5, CAP, c-Cbl-associated protein

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.766) question?

Stock #

R7040 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

40294753-40513779 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 40376800 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 180 (R180G)

Ref Sequence

ENSEMBL: ENSMUSP00000153313 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099466] [ENSMUST00000099467] [ENSMUST00000165212] [ENSMUST00000165469] [ENSMUST00000224233] [ENSMUST00000224247] [ENSMUST00000224583] [ENSMUST00000224667] [ENSMUST00000225148] [ENSMUST00000225153] [ENSMUST00000225786] [ENSMUST00000226047]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000099466

SMART Domains

Protein: ENSMUSP00000097065
Gene: ENSMUSG00000025006

Domain	Start	End	E-Value	Type
low complexity region	45	63	N/A	INTRINSIC
Sorb	203	249	1.07e-26	SMART
SH3	502	557	2.72e-18	SMART
SH3	576	633	9.32e-17	SMART
low complexity region	647	660	N/A	INTRINSIC
SH3	682	739	3.7e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000099467
AA Change: R180G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000097066
Gene: ENSMUSG00000025006
AA Change: R180G

Domain	Start	End	E-Value	Type
low complexity region	45	63	N/A	INTRINSIC
low complexity region	192	213	N/A	INTRINSIC
Sorb	327	373	1.24e-22	SMART
coiled coil region	558	584	N/A	INTRINSIC
SH3	700	755	2.72e-18	SMART
SH3	774	831	9.32e-17	SMART
low complexity region	845	858	N/A	INTRINSIC
SH3	880	937	3.7e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165212

SMART Domains

Protein: ENSMUSP00000126460
Gene: ENSMUSG00000025006

Domain	Start	End	E-Value	Type
low complexity region	45	63	N/A	INTRINSIC
Sorb	193	239	1.07e-26	SMART
SH3	486	541	2.72e-18	SMART
SH3	560	617	9.32e-17	SMART
low complexity region	631	644	N/A	INTRINSIC
SH3	666	723	3.7e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165469

SMART Domains

Protein: ENSMUSP00000125768
Gene: ENSMUSG00000025006

Domain	Start	End	E-Value	Type
low complexity region	75	93	N/A	INTRINSIC
Sorb	233	279	1.07e-26	SMART
SH3	476	531	2.72e-18	SMART
SH3	550	607	9.32e-17	SMART
low complexity region	621	634	N/A	INTRINSIC
SH3	656	713	3.7e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000224233

Predicted Effect

probably benign
Transcript: ENSMUST00000224247

Predicted Effect

probably benign
Transcript: ENSMUST00000224583

Predicted Effect

probably benign
Transcript: ENSMUST00000224667

Predicted Effect

probably benign
Transcript: ENSMUST00000225148

Predicted Effect

probably benign
Transcript: ENSMUST00000225153
AA Change: R180G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000225786

Predicted Effect

probably benign
Transcript: ENSMUST00000226047

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CBL-associated protein which functions in the signaling and stimulation of insulin. Mutations in this gene may be associated with human disorders of insulin resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased triglyceride levels, altered glucose homeostasis, decreased white blood cells and resistance to developing glucose intolerance induced by a high fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130023H24Rik	A	G	7: 128,236,725	L232P	possibly damaging	Het
Acaa1a	T	C	9: 119,349,038	V312A	probably damaging	Het
Bmp2	A	G	2: 133,561,684	D385G	probably damaging	Het
C1qtnf9	T	C	14: 60,779,792	V257A	probably damaging	Het
Cd3d	G	A	9: 44,985,693	V122I	probably damaging	Het
Cdc37	T	C	9: 21,142,223	E199G	probably damaging	Het
Crb2	T	A	2: 37,787,684	D326E	probably benign	Het
Cyp2c29	A	C	19: 39,330,337	K420N	possibly damaging	Het
Cyp2g1	A	C	7: 26,820,759	D472A	probably damaging	Het
Dab2	A	C	15: 6,422,251	H116P	probably damaging	Het
Dnah7b	G	C	1: 46,236,809	E2619Q	probably benign	Het
Dsg4	A	T	18: 20,451,852	M208L	probably benign	Het
Eif4enif1	T	G	11: 3,234,040	V521G	probably benign	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fpr-rs6	A	G	17: 20,182,934	M55T	probably damaging	Het
Grhpr	A	G	4: 44,985,362	S101G	probably damaging	Het
Kif15	T	A	9: 123,011,614	D33E	possibly damaging	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
Lama4	A	G	10: 39,060,162	Q611R	possibly damaging	Het
Lrrc47	T	A	4: 154,020,452	*123R	probably null	Het
Map4k3	A	C	17: 80,680,915	V36G	probably damaging	Het
Mme	T	A	3: 63,368,923	I707N	probably damaging	Het
Muc2	A	G	7: 141,751,457	E166G	unknown	Het
Mucl1	T	A	15: 103,753,578	T108S	possibly damaging	Het
Myo1h	A	T	5: 114,359,744	D53V	possibly damaging	Het
Naa15	T	A	3: 51,472,784	L811Q	possibly damaging	Het
Nalcn	T	C	14: 123,287,855	T1487A	probably benign	Het
Nme8	A	T	13: 19,694,328	L87H	probably damaging	Het
Nr2e1	A	G	10: 42,568,378	V245A	probably damaging	Het
Nt5c2	A	T	19: 46,893,535	F291Y	possibly damaging	Het
Olfr1337	T	C	4: 118,781,986	M200V	probably benign	Het
Olfr1508	T	C	14: 52,463,475	D178G	possibly damaging	Het
Olfr556	A	T	7: 102,670,730	Q270L	probably benign	Het
Olfr668	A	T	7: 104,925,510	C85S	probably benign	Het
Ooep	T	C	9: 78,378,401	N43S	possibly damaging	Het
Ovch2	A	T	7: 107,796,565	I82N	probably damaging	Het
Palb2	A	T	7: 122,114,399	M524K	possibly damaging	Het
Patj	T	C	4: 98,441,080	S524P	probably benign	Het
Patl1	T	A	19: 11,929,954	Y401N	possibly damaging	Het
Pcdhb20	A	T	18: 37,504,717	T99S	probably benign	Het
Plcb4	G	A	2: 135,932,262	A155T	probably benign	Het
Rpap3	A	G	15: 97,679,112	V585A	possibly damaging	Het
Spen	T	A	4: 141,494,382	T302S	unknown	Het
Tenm4	G	A	7: 96,553,496	R106H	probably benign	Het
Ube2o	T	C	11: 116,541,860	E760G	probably benign	Het
Uimc1	T	A	13: 55,075,454		probably null	Het
Usp16	C	T	16: 87,480,929	A689V	probably damaging	Het
Vmn2r60	G	A	7: 42,142,242	A530T	probably benign	Het
Vps8	T	A	16: 21,575,022	M1185K	probably damaging	Het
Vwa8	T	C	14: 78,912,205	S136P	probably damaging	Het
Ythdc2	A	G	18: 44,834,462	N175S	probably benign	Het
Zfp160	A	T	17: 21,026,532	H448L	probably damaging	Het
Zfp90	T	A	8: 106,425,009	C451*	probably null	Het
Zfp945	A	G	17: 22,852,290	C212R	probably damaging	Het

Other mutations in Sorbs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Sorbs1	APN	19	40318029	missense	probably damaging	1.00
IGL00776:Sorbs1	APN	19	40344351	splice site	probably null
IGL00788:Sorbs1	APN	19	40337043	splice site	probably benign
IGL00943:Sorbs1	APN	19	40295040	utr 3 prime	probably benign
IGL01525:Sorbs1	APN	19	40349978	missense	probably damaging	1.00
IGL01530:Sorbs1	APN	19	40376647	missense	probably benign	0.01
IGL01951:Sorbs1	APN	19	40318016	splice site	probably benign
IGL02159:Sorbs1	APN	19	40327596	missense	probably damaging	0.96
IGL02252:Sorbs1	APN	19	40314397	missense	probably damaging	1.00
IGL02613:Sorbs1	APN	19	40327547	missense	probably damaging	1.00
IGL02643:Sorbs1	APN	19	40365133	missense	possibly damaging	0.65
IGL02668:Sorbs1	APN	19	40314681	missense	probably damaging	1.00
IGL02738:Sorbs1	APN	19	40376904	missense	probably damaging	0.97
IGL02965:Sorbs1	APN	19	40376743	missense	probably benign	0.01
IGL03083:Sorbs1	APN	19	40314376	missense	probably damaging	1.00
IGL03173:Sorbs1	APN	19	40363262	missense	probably damaging	1.00
IGL03286:Sorbs1	APN	19	40344414	missense	probably damaging	0.99
IGL03292:Sorbs1	APN	19	40373565	missense	possibly damaging	0.79
R0016:Sorbs1	UTSW	19	40314738	splice site	probably benign
R0016:Sorbs1	UTSW	19	40314738	splice site	probably benign
R0306:Sorbs1	UTSW	19	40344411	missense	possibly damaging	0.94
R0526:Sorbs1	UTSW	19	40349948	missense	probably damaging	1.00
R0551:Sorbs1	UTSW	19	40311816	missense	probably damaging	1.00
R0688:Sorbs1	UTSW	19	40363262	missense	probably damaging	1.00
R1185:Sorbs1	UTSW	19	40382606	missense	probably damaging	1.00
R1185:Sorbs1	UTSW	19	40382606	missense	probably damaging	1.00
R1185:Sorbs1	UTSW	19	40382606	missense	probably damaging	1.00
R1891:Sorbs1	UTSW	19	40393460	missense	probably damaging	0.99
R2066:Sorbs1	UTSW	19	40365028	splice site	probably null
R2148:Sorbs1	UTSW	19	40376824	missense	possibly damaging	0.94
R2214:Sorbs1	UTSW	19	40296631	missense	probably damaging	1.00
R2410:Sorbs1	UTSW	19	40373515	missense	probably damaging	0.99
R2940:Sorbs1	UTSW	19	40373571	missense	probably damaging	1.00
R3847:Sorbs1	UTSW	19	40314443	missense	probably damaging	0.97
R4405:Sorbs1	UTSW	19	40395745	missense	probably benign	0.03
R4544:Sorbs1	UTSW	19	40311850	missense	probably damaging	0.99
R4618:Sorbs1	UTSW	19	40373518	missense	probably damaging	0.99
R4731:Sorbs1	UTSW	19	40314689	missense	probably benign	0.29
R4732:Sorbs1	UTSW	19	40314689	missense	probably benign	0.29
R4733:Sorbs1	UTSW	19	40314689	missense	probably benign	0.29
R4860:Sorbs1	UTSW	19	40337005	missense	probably benign	0.44
R4860:Sorbs1	UTSW	19	40337005	missense	probably benign	0.44
R4907:Sorbs1	UTSW	19	40340047	nonsense	probably null
R4912:Sorbs1	UTSW	19	40311727	missense	probably damaging	1.00
R5229:Sorbs1	UTSW	19	40340707	missense	probably damaging	1.00
R5285:Sorbs1	UTSW	19	40321890	missense	probably damaging	1.00
R5416:Sorbs1	UTSW	19	40376989	missense	probably benign	0.06
R5706:Sorbs1	UTSW	19	40376881	missense	probably benign
R5871:Sorbs1	UTSW	19	40398583	missense	probably damaging	1.00
R5936:Sorbs1	UTSW	19	40324772	missense	probably damaging	0.96
R6073:Sorbs1	UTSW	19	40314657	missense	probably damaging	1.00
R6324:Sorbs1	UTSW	19	40321819	missense	probably damaging	0.99
R6343:Sorbs1	UTSW	19	40376982	critical splice donor site	probably null
R6561:Sorbs1	UTSW	19	40326052	missense	probably benign
R6646:Sorbs1	UTSW	19	40325549	missense	probably damaging	1.00
R6768:Sorbs1	UTSW	19	40327547	missense	probably damaging	1.00
R6849:Sorbs1	UTSW	19	40376800	missense	probably benign
R6850:Sorbs1	UTSW	19	40376800	missense	probably benign
R6878:Sorbs1	UTSW	19	40376800	missense	probably benign
R6879:Sorbs1	UTSW	19	40376800	missense	probably benign
R6880:Sorbs1	UTSW	19	40376800	missense	probably benign
R6908:Sorbs1	UTSW	19	40352332	missense	probably damaging	1.00
R6980:Sorbs1	UTSW	19	40327616	nonsense	probably null
R7041:Sorbs1	UTSW	19	40376800	missense	probably benign
R7110:Sorbs1	UTSW	19	40376800	missense	probably benign
R7122:Sorbs1	UTSW	19	40376800	missense	probably benign
R7170:Sorbs1	UTSW	19	40326129	nonsense	probably null
R7180:Sorbs1	UTSW	19	40376800	missense	probably benign
R7185:Sorbs1	UTSW	19	40376800	missense	probably benign
R7187:Sorbs1	UTSW	19	40376800	missense	probably benign
R7254:Sorbs1	UTSW	19	40376800	missense	probably benign
R7255:Sorbs1	UTSW	19	40376800	missense	probably benign
R7401:Sorbs1	UTSW	19	40376800	missense	probably benign
R7595:Sorbs1	UTSW	19	40314653	missense	probably damaging	0.99
R7819:Sorbs1	UTSW	19	40376800	missense	probably benign
R7876:Sorbs1	UTSW	19	40296588	missense	probably damaging	1.00
R7894:Sorbs1	UTSW	19	40327576	missense	probably benign	0.02
R7986:Sorbs1	UTSW	19	40365005	missense	probably damaging	0.99
R8031:Sorbs1	UTSW	19	40326489	missense	probably benign	0.17
R8082:Sorbs1	UTSW	19	40365083	missense	probably benign	0.08
R8282:Sorbs1	UTSW	19	40376800	missense	probably benign
R8283:Sorbs1	UTSW	19	40376800	missense	probably benign
R8446:Sorbs1	UTSW	19	40326158	missense	probably benign
R8526:Sorbs1	UTSW	19	40376800	missense	probably benign
R8527:Sorbs1	UTSW	19	40376800	missense	probably benign
R8528:Sorbs1	UTSW	19	40376800	missense	probably benign
R8539:Sorbs1	UTSW	19	40376800	missense	probably benign
R8540:Sorbs1	UTSW	19	40376800	missense	probably benign
R8542:Sorbs1	UTSW	19	40376800	missense	probably benign
R8543:Sorbs1	UTSW	19	40376800	missense	probably benign
R8544:Sorbs1	UTSW	19	40376800	missense	probably benign
R8545:Sorbs1	UTSW	19	40376800	missense	probably benign
R8684:Sorbs1	UTSW	19	40376800	missense	probably benign
R8699:Sorbs1	UTSW	19	40376800	missense	probably benign
R8702:Sorbs1	UTSW	19	40376800	missense	probably benign
R8752:Sorbs1	UTSW	19	40361428	critical splice donor site	probably null
R8937:Sorbs1	UTSW	19	40373562	missense	probably benign	0.02
R8956:Sorbs1	UTSW	19	40363216	missense	probably damaging	1.00
R8960:Sorbs1	UTSW	19	40398604	missense	probably damaging	0.98
R9175:Sorbs1	UTSW	19	40326574	missense	probably damaging	1.00
R9208:Sorbs1	UTSW	19	40365018	start gained	probably benign
R9211:Sorbs1	UTSW	19	40344354	critical splice donor site	probably null
R9371:Sorbs1	UTSW	19	40326880	missense	probably damaging	0.98
R9374:Sorbs1	UTSW	19	40373479	nonsense	probably null
R9377:Sorbs1	UTSW	19	40398604	missense	probably damaging	0.98
Z1177:Sorbs1	UTSW	19	40326895	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GTCCAGCAAGCTTACGGTACTTG -3'
(R):5'- TTATTTCCCACAGGGTGCCAC -3'

Sequencing Primer
(F):5'- AGCTTACGGTACTTGAGACAGCTC -3'
(R):5'- CAGCCCCGTCTGAGGTAATAGTTG -3'

Posted On

2019-05-13