Incidental Mutation 'R7040:Nt5c2'
ID 547033
Institutional Source Beutler Lab
Gene Symbol Nt5c2
Ensembl Gene ENSMUSG00000025041
Gene Name 5'-nucleotidase, cytosolic II
Synonyms PNT5, NT5B, cN-II
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock # R7040 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 46886831-47015153 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 46893535 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 291 (F291Y)
Ref Sequence ENSEMBL: ENSMUSP00000084180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086961] [ENSMUST00000168536] [ENSMUST00000172239]
AlphaFold Q3V1L4
Predicted Effect possibly damaging
Transcript: ENSMUST00000086961
AA Change: F291Y

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000084180
Gene: ENSMUSG00000025041
AA Change: F291Y

DomainStartEndE-ValueType
Pfam:5_nucleotid 60 518 3.5e-185 PFAM
low complexity region 574 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168536
AA Change: F266Y

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129126
Gene: ENSMUSG00000025041
AA Change: F266Y

DomainStartEndE-ValueType
Pfam:5_nucleotid 35 493 1.6e-185 PFAM
low complexity region 549 560 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172239
AA Change: F292Y

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130898
Gene: ENSMUSG00000025041
AA Change: F292Y

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
Pfam:5_nucleotid 61 515 6.5e-179 PFAM
low complexity region 575 586 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174731
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hydrolase that serves as an important role in cellular purine metabolism by acting primarily on inosine 5'-monophosphate and other purine nucleotides. [provided by RefSeq, Oct 2011]
PHENOTYPE: Bone marrow cells with a nucleotide substitution allele used in a transplantation experiment following tamoxifen-induction produce NOTCH1-induced tumors that are resistant to 6-mercaptopurine chemotherapy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 128,236,725 L232P possibly damaging Het
Acaa1a T C 9: 119,349,038 V312A probably damaging Het
Bmp2 A G 2: 133,561,684 D385G probably damaging Het
C1qtnf9 T C 14: 60,779,792 V257A probably damaging Het
Cd3d G A 9: 44,985,693 V122I probably damaging Het
Cdc37 T C 9: 21,142,223 E199G probably damaging Het
Crb2 T A 2: 37,787,684 D326E probably benign Het
Cyp2c29 A C 19: 39,330,337 K420N possibly damaging Het
Cyp2g1 A C 7: 26,820,759 D472A probably damaging Het
Dab2 A C 15: 6,422,251 H116P probably damaging Het
Dnah7b G C 1: 46,236,809 E2619Q probably benign Het
Dsg4 A T 18: 20,451,852 M208L probably benign Het
Eif4enif1 T G 11: 3,234,040 V521G probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fpr-rs6 A G 17: 20,182,934 M55T probably damaging Het
Grhpr A G 4: 44,985,362 S101G probably damaging Het
Kif15 T A 9: 123,011,614 D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,060,162 Q611R possibly damaging Het
Lrrc47 T A 4: 154,020,452 *123R probably null Het
Map4k3 A C 17: 80,680,915 V36G probably damaging Het
Mme T A 3: 63,368,923 I707N probably damaging Het
Muc2 A G 7: 141,751,457 E166G unknown Het
Mucl1 T A 15: 103,753,578 T108S possibly damaging Het
Myo1h A T 5: 114,359,744 D53V possibly damaging Het
Naa15 T A 3: 51,472,784 L811Q possibly damaging Het
Nalcn T C 14: 123,287,855 T1487A probably benign Het
Nme8 A T 13: 19,694,328 L87H probably damaging Het
Nr2e1 A G 10: 42,568,378 V245A probably damaging Het
Olfr1337 T C 4: 118,781,986 M200V probably benign Het
Olfr1508 T C 14: 52,463,475 D178G possibly damaging Het
Olfr556 A T 7: 102,670,730 Q270L probably benign Het
Olfr668 A T 7: 104,925,510 C85S probably benign Het
Ooep T C 9: 78,378,401 N43S possibly damaging Het
Ovch2 A T 7: 107,796,565 I82N probably damaging Het
Palb2 A T 7: 122,114,399 M524K possibly damaging Het
Patj T C 4: 98,441,080 S524P probably benign Het
Patl1 T A 19: 11,929,954 Y401N possibly damaging Het
Pcdhb20 A T 18: 37,504,717 T99S probably benign Het
Plcb4 G A 2: 135,932,262 A155T probably benign Het
Rpap3 A G 15: 97,679,112 V585A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spen T A 4: 141,494,382 T302S unknown Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ube2o T C 11: 116,541,860 E760G probably benign Het
Uimc1 T A 13: 55,075,454 probably null Het
Usp16 C T 16: 87,480,929 A689V probably damaging Het
Vmn2r60 G A 7: 42,142,242 A530T probably benign Het
Vps8 T A 16: 21,575,022 M1185K probably damaging Het
Vwa8 T C 14: 78,912,205 S136P probably damaging Het
Ythdc2 A G 18: 44,834,462 N175S probably benign Het
Zfp160 A T 17: 21,026,532 H448L probably damaging Het
Zfp90 T A 8: 106,425,009 C451* probably null Het
Zfp945 A G 17: 22,852,290 C212R probably damaging Het
Other mutations in Nt5c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Nt5c2 APN 19 46896515 missense possibly damaging 0.91
IGL00814:Nt5c2 APN 19 46897648 missense probably benign 0.02
IGL02347:Nt5c2 APN 19 46924256 splice site probably benign
IGL02630:Nt5c2 APN 19 46924310 missense probably benign 0.00
tightrope UTSW 19 46924327 missense probably damaging 1.00
R0565:Nt5c2 UTSW 19 46897625 missense probably damaging 0.99
R0825:Nt5c2 UTSW 19 46898905 unclassified probably benign
R0980:Nt5c2 UTSW 19 46898878 missense probably benign
R1496:Nt5c2 UTSW 19 46904978 missense probably damaging 1.00
R2394:Nt5c2 UTSW 19 46890067 critical splice donor site probably null
R3854:Nt5c2 UTSW 19 46896518 missense probably damaging 1.00
R3855:Nt5c2 UTSW 19 46896518 missense probably damaging 1.00
R3856:Nt5c2 UTSW 19 46896518 missense probably damaging 1.00
R4534:Nt5c2 UTSW 19 46891661 missense probably damaging 1.00
R4907:Nt5c2 UTSW 19 46896539 missense possibly damaging 0.71
R5122:Nt5c2 UTSW 19 46889921 missense probably damaging 1.00
R5203:Nt5c2 UTSW 19 46889808 missense probably damaging 1.00
R5226:Nt5c2 UTSW 19 46898629 missense probably damaging 1.00
R5254:Nt5c2 UTSW 19 46893560 nonsense probably null
R5315:Nt5c2 UTSW 19 46892243 missense probably damaging 1.00
R6401:Nt5c2 UTSW 19 46889811 missense probably benign 0.11
R6784:Nt5c2 UTSW 19 46924327 missense probably damaging 1.00
R7414:Nt5c2 UTSW 19 46889889 missense probably damaging 1.00
R7792:Nt5c2 UTSW 19 46889946 missense probably benign 0.02
R7793:Nt5c2 UTSW 19 46891581 missense probably benign 0.23
R8380:Nt5c2 UTSW 19 46889050 missense probably damaging 1.00
R8954:Nt5c2 UTSW 19 46888922 missense probably damaging 0.98
R9429:Nt5c2 UTSW 19 46889020 missense probably benign 0.08
X0028:Nt5c2 UTSW 19 46891615 missense probably damaging 1.00
X0065:Nt5c2 UTSW 19 46890088 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AGCCTCTTTCTCGGTGCAAC -3'
(R):5'- GTGCCTTTGCCTGATGAAGC -3'

Sequencing Primer
(F):5'- TGTCAAGGATGTCCACATGAC -3'
(R):5'- CCTTTGCCTGATGAAGCATTAG -3'
Posted On 2019-05-13