Incidental Mutation 'R7041:Plekha6'
ID547035
Institutional Source Beutler Lab
Gene Symbol Plekha6
Ensembl Gene ENSMUSG00000041757
Gene Namepleckstrin homology domain containing, family A member 6
SynonymsPepp3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R7041 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location133164210-133303435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 133272460 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 259 (V259D)
Ref Sequence ENSEMBL: ENSMUSP00000048214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038295] [ENSMUST00000105082] [ENSMUST00000186917] [ENSMUST00000187285] [ENSMUST00000212252]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038295
AA Change: V259D

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048214
Gene: ENSMUSG00000041757
AA Change: V259D

DomainStartEndE-ValueType
PH 60 160 2.23e-20 SMART
low complexity region 217 231 N/A INTRINSIC
low complexity region 353 367 N/A INTRINSIC
Blast:PH 506 576 6e-31 BLAST
coiled coil region 613 686 N/A INTRINSIC
low complexity region 761 782 N/A INTRINSIC
low complexity region 789 808 N/A INTRINSIC
low complexity region 812 827 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105082
AA Change: V279D

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000100703
Gene: ENSMUSG00000041757
AA Change: V279D

DomainStartEndE-ValueType
PH 60 180 1.24e-18 SMART
low complexity region 237 251 N/A INTRINSIC
low complexity region 373 387 N/A INTRINSIC
coiled coil region 559 632 N/A INTRINSIC
low complexity region 707 728 N/A INTRINSIC
low complexity region 1035 1049 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186917
AA Change: V279D

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139794
Gene: ENSMUSG00000041757
AA Change: V279D

DomainStartEndE-ValueType
PH 60 180 1.24e-18 SMART
low complexity region 237 251 N/A INTRINSIC
low complexity region 373 387 N/A INTRINSIC
coiled coil region 559 632 N/A INTRINSIC
low complexity region 707 728 N/A INTRINSIC
low complexity region 1035 1049 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187285
AA Change: V259D

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140558
Gene: ENSMUSG00000041757
AA Change: V259D

DomainStartEndE-ValueType
PH 60 160 9.6e-23 SMART
low complexity region 217 231 N/A INTRINSIC
low complexity region 353 367 N/A INTRINSIC
coiled coil region 539 612 N/A INTRINSIC
low complexity region 687 708 N/A INTRINSIC
low complexity region 1014 1028 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187299
Predicted Effect probably benign
Transcript: ENSMUST00000189598
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000212252
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G T 7: 79,098,348 E956* probably null Het
Adam25 A T 8: 40,754,084 H129L probably benign Het
Adgrl4 A T 3: 151,439,322 H36L probably benign Het
Ago1 T A 4: 126,463,706 I59F possibly damaging Het
Anapc1 A T 2: 128,628,656 V1518E possibly damaging Het
Atxn1 A G 13: 45,566,835 I528T probably damaging Het
B4galnt4 A G 7: 141,070,680 H820R probably damaging Het
Cacna1h T C 17: 25,394,003 E282G probably damaging Het
Camk1 T A 6: 113,339,514 M95L probably benign Het
Capn7 C T 14: 31,336,685 probably benign Het
Cav1 A G 6: 17,339,144 E45G possibly damaging Het
Ccdc183 T G 2: 25,613,670 E185A probably benign Het
Ccl2 T A 11: 82,035,663 M1K probably null Het
Cep97 T A 16: 55,905,754 H590L probably benign Het
Dsg1c A T 18: 20,266,144 I102F probably damaging Het
Fam198a A T 9: 121,965,401 Q207L probably damaging Het
Fcho2 A G 13: 98,784,826 Y184H possibly damaging Het
Gart C T 16: 91,643,143 probably benign Het
Golga3 G A 5: 110,208,584 probably null Het
Hint3 G T 10: 30,610,384 A133E probably damaging Het
Hspe1 T C 1: 55,089,217 probably null Het
Insr A T 8: 3,258,418 V206E probably benign Het
Insrr T C 3: 87,815,244 S1258P probably damaging Het
Itga11 C T 9: 62,752,256 T430M probably damaging Het
Jmjd1c G A 10: 67,220,609 V890I possibly damaging Het
Kdm4b T A 17: 56,396,592 S717R probably damaging Het
Large1 A T 8: 73,116,464 C144S probably damaging Het
Lrat G T 3: 82,903,448 Q89K probably benign Het
Lrrc66 A T 5: 73,608,556 F381L possibly damaging Het
Myo15 A G 11: 60,506,006 T2634A probably damaging Het
Nup205 T G 6: 35,224,535 I1182M possibly damaging Het
Olfr1023 A T 2: 85,887,621 I274F probably benign Het
Olfr435 T A 6: 43,201,903 D86E probably benign Het
Olfr798 T A 10: 129,625,734 E109V probably damaging Het
Prdm9 C A 17: 15,544,995 A508S possibly damaging Het
Prickle2 A G 6: 92,376,305 F783L probably benign Het
Ptprc T C 1: 138,126,309 S31G probably benign Het
Rbak A T 5: 143,173,471 I609N probably damaging Het
Rimklb A T 6: 122,459,217 L134* probably null Het
Ripor2 A G 13: 24,693,766 I250V probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spaca6 C T 17: 17,836,096 L118F probably benign Het
Tmem167 G A 13: 90,098,414 C19Y probably benign Het
Togaram1 C T 12: 65,020,386 T1684I possibly damaging Het
Trappc8 T C 18: 20,874,672 T129A probably benign Het
Ubash3a A G 17: 31,228,210 S347G probably benign Het
Unc80 T C 1: 66,503,593 S289P probably benign Het
Vmn2r11 A G 5: 109,054,950 I87T probably damaging Het
Vmn2r54 A T 7: 12,629,824 F381I probably damaging Het
Wdsub1 A G 2: 59,852,880 L450P probably damaging Het
Xylt2 A G 11: 94,667,582 probably null Het
Zfp429 A T 13: 67,390,711 C205S probably damaging Het
Zfp60 T C 7: 27,749,026 I373T probably benign Het
Zfp738 A G 13: 67,670,301 S524P probably damaging Het
Other mutations in Plekha6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Plekha6 APN 1 133282165 missense possibly damaging 0.92
IGL01328:Plekha6 APN 1 133272336 unclassified probably null
IGL01739:Plekha6 APN 1 133260131 missense probably benign 0.38
IGL01803:Plekha6 APN 1 133272414 nonsense probably null
IGL02053:Plekha6 APN 1 133272492 missense probably damaging 1.00
IGL02269:Plekha6 APN 1 133287849 missense possibly damaging 0.82
IGL02276:Plekha6 APN 1 133293861 missense possibly damaging 0.93
IGL02478:Plekha6 APN 1 133283293 missense probably benign 0.03
IGL02754:Plekha6 APN 1 133284938 missense probably damaging 0.98
R0100:Plekha6 UTSW 1 133270177 missense probably damaging 0.99
R0334:Plekha6 UTSW 1 133282180 missense probably benign 0.24
R0470:Plekha6 UTSW 1 133272307 missense probably benign 0.07
R1016:Plekha6 UTSW 1 133260094 missense probably benign 0.00
R1254:Plekha6 UTSW 1 133272589 missense probably benign 0.10
R1728:Plekha6 UTSW 1 133287846 missense probably benign
R1729:Plekha6 UTSW 1 133287846 missense probably benign
R1730:Plekha6 UTSW 1 133287846 missense probably benign
R1739:Plekha6 UTSW 1 133287846 missense probably benign
R1762:Plekha6 UTSW 1 133287846 missense probably benign
R1771:Plekha6 UTSW 1 133273913 missense probably benign 0.00
R1783:Plekha6 UTSW 1 133287846 missense probably benign
R1784:Plekha6 UTSW 1 133287846 missense probably benign
R1785:Plekha6 UTSW 1 133287846 missense probably benign
R1786:Plekha6 UTSW 1 133279365 intron probably null
R1997:Plekha6 UTSW 1 133263818 missense probably benign 0.43
R2020:Plekha6 UTSW 1 133284970 missense possibly damaging 0.55
R2130:Plekha6 UTSW 1 133279365 intron probably null
R2131:Plekha6 UTSW 1 133279365 intron probably null
R2133:Plekha6 UTSW 1 133279365 intron probably null
R2992:Plekha6 UTSW 1 133294658 missense probably damaging 1.00
R3781:Plekha6 UTSW 1 133294655 missense probably damaging 1.00
R3810:Plekha6 UTSW 1 133273979 missense probably benign
R4067:Plekha6 UTSW 1 133294678 missense probably benign 0.40
R4725:Plekha6 UTSW 1 133283320 missense probably damaging 1.00
R5657:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5658:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5746:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5768:Plekha6 UTSW 1 133280378 missense probably benign 0.01
R5785:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5892:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5937:Plekha6 UTSW 1 133260101 missense possibly damaging 0.89
R5985:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5986:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R6053:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R6072:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R6167:Plekha6 UTSW 1 133279407 missense probably null 0.96
R6843:Plekha6 UTSW 1 133274878 missense probably damaging 1.00
R6879:Plekha6 UTSW 1 133260055 missense possibly damaging 0.95
R6912:Plekha6 UTSW 1 133272535 missense probably benign 0.02
R6970:Plekha6 UTSW 1 133263818 missense probably benign 0.43
R7248:Plekha6 UTSW 1 133275848 nonsense probably null
R7400:Plekha6 UTSW 1 133274024 nonsense probably null
R7720:Plekha6 UTSW 1 133293707 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGAGAAGCCAGACTCAGAG -3'
(R):5'- TGCTGAAGCTGGTTCATAGAG -3'

Sequencing Primer
(F):5'- ATCTCACCAAGCTGGAGCCTG -3'
(R):5'- CTGAAGCTGGTTCATAGAGCTTTTGC -3'
Posted On2019-05-13