Mutagenetix > Incidental Mutations

Incidental Mutation 'R7041:Anapc1'

547040

Institutional Source

Beutler Lab

Gene Symbol

Anapc1

Ensembl Gene

ENSMUSG00000014355

Gene Name

anaphase promoting complex subunit 1

Synonyms

2610021O03Rik, tsg24, Apc1, Mcpr

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7041 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128610104-128687391 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 128628656 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 1518 (V1518E)

Ref Sequence

ENSEMBL: ENSMUSP00000014499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014499]

AlphaFold

P53995

Predicted Effect

possibly damaging
Transcript: ENSMUST00000014499
AA Change: V1518E

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: V1518E

Domain	Start	End	E-Value	Type
Pfam:ANAPC1	150	214	1.7e-13	PFAM
low complexity region	323	345	N/A	INTRINSIC
low complexity region	1404	1415	N/A	INTRINSIC
Pfam:PC_rep	1467	1501	8.3e-8	PFAM
low complexity region	1516	1528	N/A	INTRINSIC
low complexity region	1924	1936	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	G	T	7: 79,098,348	E956*	probably null	Het
Adam25	A	T	8: 40,754,084	H129L	probably benign	Het
Adgrl4	A	T	3: 151,439,322	H36L	probably benign	Het
Ago1	T	A	4: 126,463,706	I59F	possibly damaging	Het
Atxn1	A	G	13: 45,566,835	I528T	probably damaging	Het
B4galnt4	A	G	7: 141,070,680	H820R	probably damaging	Het
Cacna1h	T	C	17: 25,394,003	E282G	probably damaging	Het
Camk1	T	A	6: 113,339,514	M95L	probably benign	Het
Capn7	C	T	14: 31,336,685		probably benign	Het
Cav1	A	G	6: 17,339,144	E45G	possibly damaging	Het
Ccdc183	T	G	2: 25,613,670	E185A	probably benign	Het
Ccl2	T	A	11: 82,035,663	M1K	probably null	Het
Cep97	T	A	16: 55,905,754	H590L	probably benign	Het
Dsg1c	A	T	18: 20,266,144	I102F	probably damaging	Het
Fam198a	A	T	9: 121,965,401	Q207L	probably damaging	Het
Fcho2	A	G	13: 98,784,826	Y184H	possibly damaging	Het
Gart	C	T	16: 91,643,143		probably benign	Het
Golga3	G	A	5: 110,208,584		probably null	Het
Hint3	G	T	10: 30,610,384	A133E	probably damaging	Het
Hspe1	T	C	1: 55,089,217		probably null	Het
Insr	A	T	8: 3,258,418	V206E	probably benign	Het
Insrr	T	C	3: 87,815,244	S1258P	probably damaging	Het
Itga11	C	T	9: 62,752,256	T430M	probably damaging	Het
Jmjd1c	G	A	10: 67,220,609	V890I	possibly damaging	Het
Kdm4b	T	A	17: 56,396,592	S717R	probably damaging	Het
Large1	A	T	8: 73,116,464	C144S	probably damaging	Het
Lrat	G	T	3: 82,903,448	Q89K	probably benign	Het
Lrrc66	A	T	5: 73,608,556	F381L	possibly damaging	Het
Myo15	A	G	11: 60,506,006	T2634A	probably damaging	Het
Nup205	T	G	6: 35,224,535	I1182M	possibly damaging	Het
Olfr1023	A	T	2: 85,887,621	I274F	probably benign	Het
Olfr435	T	A	6: 43,201,903	D86E	probably benign	Het
Olfr798	T	A	10: 129,625,734	E109V	probably damaging	Het
Plekha6	T	A	1: 133,272,460	V259D	possibly damaging	Het
Prdm9	C	A	17: 15,544,995	A508S	possibly damaging	Het
Prickle2	A	G	6: 92,376,305	F783L	probably benign	Het
Ptprc	T	C	1: 138,126,309	S31G	probably benign	Het
Rbak	A	T	5: 143,173,471	I609N	probably damaging	Het
Rimklb	A	T	6: 122,459,217	L134*	probably null	Het
Ripor2	A	G	13: 24,693,766	I250V	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Spaca6	C	T	17: 17,836,096	L118F	probably benign	Het
Tmem167	G	A	13: 90,098,414	C19Y	probably benign	Het
Togaram1	C	T	12: 65,020,386	T1684I	possibly damaging	Het
Trappc8	T	C	18: 20,874,672	T129A	probably benign	Het
Ubash3a	A	G	17: 31,228,210	S347G	probably benign	Het
Unc80	T	C	1: 66,503,593	S289P	probably benign	Het
Vmn2r11	A	G	5: 109,054,950	I87T	probably damaging	Het
Vmn2r54	A	T	7: 12,629,824	F381I	probably damaging	Het
Wdsub1	A	G	2: 59,852,880	L450P	probably damaging	Het
Xylt2	A	G	11: 94,667,582		probably null	Het
Zfp429	A	T	13: 67,390,711	C205S	probably damaging	Het
Zfp60	T	C	7: 27,749,026	I373T	probably benign	Het
Zfp738	A	G	13: 67,670,301	S524P	probably damaging	Het

Other mutations in Anapc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Anapc1	APN	2	128645130	splice site	probably benign
IGL00704:Anapc1	APN	2	128663984	missense	possibly damaging	0.48
IGL01023:Anapc1	APN	2	128629729	missense	probably damaging	1.00
IGL01432:Anapc1	APN	2	128633408	missense	probably damaging	1.00
IGL01549:Anapc1	APN	2	128653170	missense	probably benign
IGL02089:Anapc1	APN	2	128663933	missense	probably damaging	1.00
IGL02275:Anapc1	APN	2	128659852	missense	probably benign
IGL02570:Anapc1	APN	2	128645200	missense	probably damaging	1.00
IGL02597:Anapc1	APN	2	128623931	missense	probably benign	0.02
IGL02726:Anapc1	APN	2	128659785	missense	probably benign	0.05
IGL03265:Anapc1	APN	2	128627197	missense	probably damaging	1.00
IGL03304:Anapc1	APN	2	128627113	splice site	probably benign
IGL03327:Anapc1	APN	2	128623934	missense	probably benign	0.00
R0023:Anapc1	UTSW	2	128678218	missense	probably damaging	0.99
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0084:Anapc1	UTSW	2	128623966	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0255:Anapc1	UTSW	2	128634711	missense	probably damaging	0.99
R0377:Anapc1	UTSW	2	128641340	critical splice donor site	probably null
R0467:Anapc1	UTSW	2	128669043	missense	probably damaging	0.99
R0514:Anapc1	UTSW	2	128632655	missense	probably damaging	0.99
R0591:Anapc1	UTSW	2	128619332	missense	probably benign	0.17
R0919:Anapc1	UTSW	2	128617731	missense	probably benign
R1175:Anapc1	UTSW	2	128680188	missense	probably damaging	1.00
R1473:Anapc1	UTSW	2	128617697	missense	possibly damaging	0.88
R1547:Anapc1	UTSW	2	128617556	missense	probably benign	0.44
R1556:Anapc1	UTSW	2	128624899	missense	probably benign	0.00
R1567:Anapc1	UTSW	2	128617716	missense	probably damaging	1.00
R1635:Anapc1	UTSW	2	128628532	missense	probably damaging	1.00
R1645:Anapc1	UTSW	2	128658246	critical splice donor site	probably null
R1677:Anapc1	UTSW	2	128676208	missense	probably benign	0.09
R1854:Anapc1	UTSW	2	128675890	missense	probably damaging	1.00
R1856:Anapc1	UTSW	2	128659788	missense	probably damaging	0.96
R1959:Anapc1	UTSW	2	128633415	missense	probably benign	0.36
R1984:Anapc1	UTSW	2	128669688	missense	possibly damaging	0.85
R2034:Anapc1	UTSW	2	128648458	missense	possibly damaging	0.92
R2283:Anapc1	UTSW	2	128642548	missense	probably benign	0.23
R2928:Anapc1	UTSW	2	128680137	missense	probably damaging	1.00
R3547:Anapc1	UTSW	2	128642682	missense	possibly damaging	0.58
R3904:Anapc1	UTSW	2	128642519	missense	probably damaging	1.00
R4156:Anapc1	UTSW	2	128627229	intron	probably benign
R4359:Anapc1	UTSW	2	128623556	missense	possibly damaging	0.64
R4392:Anapc1	UTSW	2	128676249	critical splice acceptor site	probably null
R4574:Anapc1	UTSW	2	128627195	missense	probably damaging	1.00
R4682:Anapc1	UTSW	2	128664005	missense	probably benign	0.05
R4770:Anapc1	UTSW	2	128686060	splice site	probably benign
R4824:Anapc1	UTSW	2	128628690	missense	possibly damaging	0.69
R4960:Anapc1	UTSW	2	128684594	missense	probably benign	0.23
R5016:Anapc1	UTSW	2	128607175	unclassified	probably benign
R5063:Anapc1	UTSW	2	128629549	missense	possibly damaging	0.48
R5128:Anapc1	UTSW	2	128659917	missense	probably benign
R5271:Anapc1	UTSW	2	128685985	nonsense	probably null
R5363:Anapc1	UTSW	2	128650194	critical splice donor site	probably null
R5469:Anapc1	UTSW	2	128675701	nonsense	probably null
R5473:Anapc1	UTSW	2	128607195	unclassified	probably benign
R5559:Anapc1	UTSW	2	128680434	nonsense	probably null
R5631:Anapc1	UTSW	2	128657217	missense	possibly damaging	0.85
R5747:Anapc1	UTSW	2	128624916	missense	probably benign	0.19
R5840:Anapc1	UTSW	2	128607037	unclassified	probably benign
R6226:Anapc1	UTSW	2	128650372	missense	probably damaging	1.00
R6526:Anapc1	UTSW	2	128672135	nonsense	probably null
R6561:Anapc1	UTSW	2	128663999	missense	probably damaging	0.98
R6743:Anapc1	UTSW	2	128684534	nonsense	probably null
R6799:Anapc1	UTSW	2	128659737	missense	probably null	0.38
R6887:Anapc1	UTSW	2	128659768	missense	possibly damaging	0.91
R6978:Anapc1	UTSW	2	128669900	missense	probably benign	0.06
R7011:Anapc1	UTSW	2	128648681	splice site	probably null
R7047:Anapc1	UTSW	2	128615430	missense	probably damaging	0.96
R7074:Anapc1	UTSW	2	128678274	missense	probably damaging	1.00
R7109:Anapc1	UTSW	2	128674602	missense	probably benign	0.33
R7123:Anapc1	UTSW	2	128613010	missense	probably damaging	1.00
R7309:Anapc1	UTSW	2	128674684	missense	probably damaging	0.96
R7693:Anapc1	UTSW	2	128641537	missense	possibly damaging	0.86
R7839:Anapc1	UTSW	2	128684608	missense	probably damaging	0.99
R7847:Anapc1	UTSW	2	128669908	missense	possibly damaging	0.93
R7960:Anapc1	UTSW	2	128674593	missense	probably damaging	1.00
R8061:Anapc1	UTSW	2	128648488	missense	probably damaging	0.98
R8127:Anapc1	UTSW	2	128632627	missense	probably damaging	0.96
R8228:Anapc1	UTSW	2	128619917	nonsense	probably null
R8402:Anapc1	UTSW	2	128630228	missense	probably benign	0.02
R8422:Anapc1	UTSW	2	128675837	missense	probably benign
R8425:Anapc1	UTSW	2	128669868	missense	probably damaging	1.00
R8469:Anapc1	UTSW	2	128658344	splice site	probably null
R8553:Anapc1	UTSW	2	128619913	missense	possibly damaging	0.80
R8688:Anapc1	UTSW	2	128685828	missense	probably benign	0.19
R8699:Anapc1	UTSW	2	128641453	missense	probably damaging	1.00
R8719:Anapc1	UTSW	2	128641449	missense	probably damaging	1.00
R8775:Anapc1	UTSW	2	128657173	missense	possibly damaging	0.92
R8775-TAIL:Anapc1	UTSW	2	128657173	missense	possibly damaging	0.92
R8806:Anapc1	UTSW	2	128622413	missense	possibly damaging	0.67
R8973:Anapc1	UTSW	2	128664032	missense	probably damaging	0.99
R8977:Anapc1	UTSW	2	128641402	missense	probably damaging	1.00
R9000:Anapc1	UTSW	2	128634708	missense	probably damaging	1.00
R9080:Anapc1	UTSW	2	128622506	missense	possibly damaging	0.82
R9203:Anapc1	UTSW	2	128623502	missense	possibly damaging	0.66
R9314:Anapc1	UTSW	2	128622500	missense	possibly damaging	0.69
R9386:Anapc1	UTSW	2	128617722	missense	probably benign	0.08
R9415:Anapc1	UTSW	2	128634678	missense	not run
R9436:Anapc1	UTSW	2	128676125	missense	not run
X0066:Anapc1	UTSW	2	128674701	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- AGCTCTCCCTCATGAACTCT -3'
(R):5'- AATATCAGTTTTCAGTAGGTGGTGGG -3'

Sequencing Primer
(F):5'- TCCCTCATGAACTCTTTTATTAAAGG -3'
(R):5'- ACACTAGGTAATGTTTTTGTG -3'

Posted On

2019-05-13