Mutagenetix > Incidental Mutation

Incidental Mutation 'R7041:Ago1'

547044

Institutional Source

Beutler Lab

Gene Symbol

Ago1

Ensembl Gene

ENSMUSG00000041530

Gene Name

argonaute RISC catalytic subunit 1

Synonyms

Eif2c1, argonaute 1

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.811) question?

Stock #

R7041 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

126435012-126468583 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 126463706 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 59 (I59F)

Ref Sequence

ENSEMBL: ENSMUSP00000095498 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]

AlphaFold

Q8CJG1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000097888
AA Change: I59F

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: I59F

Domain	Start	End	E-Value	Type
Pfam:ArgoN	26	164	2.3e-26	PFAM
DUF1785	173	225	3.48e-25	SMART
PAZ	233	368	1.41e-5	SMART
Pfam:ArgoL2	373	418	3.6e-18	PFAM
Pfam:ArgoMid	427	509	7.6e-37	PFAM
Piwi	515	816	4.16e-131	SMART
Blast:Piwi	823	849	3e-6	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000127800

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149425

Predicted Effect

probably benign
Transcript: ENSMUST00000176315

SMART Domains

Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530

Domain	Start	End	E-Value	Type
Pfam:PAZ	1	62	4.1e-23	PFAM
Piwi	211	512	4.16e-131	SMART
Blast:Piwi	519	545	2e-6	BLAST

Meta Mutation Damage Score

0.3507

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	G	T	7: 79,098,348	E956*	probably null	Het
Adam25	A	T	8: 40,754,084	H129L	probably benign	Het
Adgrl4	A	T	3: 151,439,322	H36L	probably benign	Het
Anapc1	A	T	2: 128,628,656	V1518E	possibly damaging	Het
Atxn1	A	G	13: 45,566,835	I528T	probably damaging	Het
B4galnt4	A	G	7: 141,070,680	H820R	probably damaging	Het
Cacna1h	T	C	17: 25,394,003	E282G	probably damaging	Het
Camk1	T	A	6: 113,339,514	M95L	probably benign	Het
Capn7	C	T	14: 31,336,685		probably benign	Het
Cav1	A	G	6: 17,339,144	E45G	possibly damaging	Het
Ccdc183	T	G	2: 25,613,670	E185A	probably benign	Het
Ccl2	T	A	11: 82,035,663	M1K	probably null	Het
Cep97	T	A	16: 55,905,754	H590L	probably benign	Het
Dsg1c	A	T	18: 20,266,144	I102F	probably damaging	Het
Fam198a	A	T	9: 121,965,401	Q207L	probably damaging	Het
Fcho2	A	G	13: 98,784,826	Y184H	possibly damaging	Het
Gart	C	T	16: 91,643,143		probably benign	Het
Golga3	G	A	5: 110,208,584		probably null	Het
Hint3	G	T	10: 30,610,384	A133E	probably damaging	Het
Hspe1	T	C	1: 55,089,217		probably null	Het
Insr	A	T	8: 3,258,418	V206E	probably benign	Het
Insrr	T	C	3: 87,815,244	S1258P	probably damaging	Het
Itga11	C	T	9: 62,752,256	T430M	probably damaging	Het
Jmjd1c	G	A	10: 67,220,609	V890I	possibly damaging	Het
Kdm4b	T	A	17: 56,396,592	S717R	probably damaging	Het
Large1	A	T	8: 73,116,464	C144S	probably damaging	Het
Lrat	G	T	3: 82,903,448	Q89K	probably benign	Het
Lrrc66	A	T	5: 73,608,556	F381L	possibly damaging	Het
Myo15	A	G	11: 60,506,006	T2634A	probably damaging	Het
Nup205	T	G	6: 35,224,535	I1182M	possibly damaging	Het
Olfr1023	A	T	2: 85,887,621	I274F	probably benign	Het
Olfr435	T	A	6: 43,201,903	D86E	probably benign	Het
Olfr798	T	A	10: 129,625,734	E109V	probably damaging	Het
Plekha6	T	A	1: 133,272,460	V259D	possibly damaging	Het
Prdm9	C	A	17: 15,544,995	A508S	possibly damaging	Het
Prickle2	A	G	6: 92,376,305	F783L	probably benign	Het
Ptprc	T	C	1: 138,126,309	S31G	probably benign	Het
Rbak	A	T	5: 143,173,471	I609N	probably damaging	Het
Rimklb	A	T	6: 122,459,217	L134*	probably null	Het
Ripor2	A	G	13: 24,693,766	I250V	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Spaca6	C	T	17: 17,836,096	L118F	probably benign	Het
Tmem167	G	A	13: 90,098,414	C19Y	probably benign	Het
Togaram1	C	T	12: 65,020,386	T1684I	possibly damaging	Het
Trappc8	T	C	18: 20,874,672	T129A	probably benign	Het
Ubash3a	A	G	17: 31,228,210	S347G	probably benign	Het
Unc80	T	C	1: 66,503,593	S289P	probably benign	Het
Vmn2r11	A	G	5: 109,054,950	I87T	probably damaging	Het
Vmn2r54	A	T	7: 12,629,824	F381I	probably damaging	Het
Wdsub1	A	G	2: 59,852,880	L450P	probably damaging	Het
Xylt2	A	G	11: 94,667,582		probably null	Het
Zfp429	A	T	13: 67,390,711	C205S	probably damaging	Het
Zfp60	T	C	7: 27,749,026	I373T	probably benign	Het
Zfp738	A	G	13: 67,670,301	S524P	probably damaging	Het

Other mutations in Ago1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01377:Ago1	APN	4	126459817	missense	probably damaging	0.98
IGL02578:Ago1	APN	4	126439531	missense	probably benign	0.12
IGL02709:Ago1	APN	4	126453640	nonsense	probably null
IGL02810:Ago1	APN	4	126443093	missense	probably benign	0.00
IGL03037:Ago1	APN	4	126461794	missense	probably benign	0.00
IGL03091:Ago1	APN	4	126459189	missense	probably damaging	0.98
IGL03100:Ago1	APN	4	126443171	missense	probably benign	0.08
IGL03121:Ago1	APN	4	126460003	missense	probably benign	0.00
R0195:Ago1	UTSW	4	126463691	missense	probably benign	0.01
R0244:Ago1	UTSW	4	126463706	missense	possibly damaging	0.94
R0309:Ago1	UTSW	4	126443166	missense	probably benign	0.06
R0514:Ago1	UTSW	4	126439595	missense	probably benign
R0557:Ago1	UTSW	4	126460024	missense	probably benign	0.00
R1104:Ago1	UTSW	4	126453633	missense	probably damaging	0.99
R1553:Ago1	UTSW	4	126440401	missense	probably damaging	0.99
R1624:Ago1	UTSW	4	126463741	missense	probably damaging	0.97
R1851:Ago1	UTSW	4	126439995	missense	probably benign	0.00
R1867:Ago1	UTSW	4	126441236	missense	probably damaging	0.98
R2001:Ago1	UTSW	4	126454394	missense	probably null	0.36
R2051:Ago1	UTSW	4	126460453	missense	probably benign	0.01
R2057:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R2105:Ago1	UTSW	4	126461788	missense	probably benign	0.30
R2117:Ago1	UTSW	4	126463857	splice site	probably null
R2256:Ago1	UTSW	4	126441911	missense	possibly damaging	0.80
R2272:Ago1	UTSW	4	126453650	missense	probably benign	0.01
R2517:Ago1	UTSW	4	126439939	nonsense	probably null
R2850:Ago1	UTSW	4	126443075	splice site	probably benign
R2993:Ago1	UTSW	4	126440046	splice site	probably benign
R3746:Ago1	UTSW	4	126461044	missense	probably benign
R3747:Ago1	UTSW	4	126461044	missense	probably benign
R3750:Ago1	UTSW	4	126461044	missense	probably benign
R4600:Ago1	UTSW	4	126460392	missense	probably benign	0.37
R4934:Ago1	UTSW	4	126448859	missense	possibly damaging	0.56
R4983:Ago1	UTSW	4	126453654	missense	probably damaging	0.99
R5086:Ago1	UTSW	4	126453604	missense	probably benign	0.01
R5132:Ago1	UTSW	4	126461723	missense	probably benign	0.01
R5239:Ago1	UTSW	4	126441215	missense	probably damaging	1.00
R5609:Ago1	UTSW	4	126461037	missense	possibly damaging	0.80
R5705:Ago1	UTSW	4	126448794	missense	probably benign	0.01
R5980:Ago1	UTSW	4	126460569	unclassified	probably benign
R6036:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R6036:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R6398:Ago1	UTSW	4	126448808	missense	probably benign	0.26
R6505:Ago1	UTSW	4	126463835	missense	probably benign	0.00
R6545:Ago1	UTSW	4	126454352	missense	possibly damaging	0.74
R6944:Ago1	UTSW	4	126460422	missense	possibly damaging	0.78
R7490:Ago1	UTSW	4	126439505	makesense	probably null
R7496:Ago1	UTSW	4	126461752	missense	probably benign	0.20
R7575:Ago1	UTSW	4	126453908	missense	probably benign	0.12
R7625:Ago1	UTSW	4	126443229	missense	probably benign	0.18
R7988:Ago1	UTSW	4	126460417	missense	probably damaging	1.00
R8041:Ago1	UTSW	4	126441936	missense	probably damaging	1.00
R8073:Ago1	UTSW	4	126443226	missense	probably benign	0.04
R8086:Ago1	UTSW	4	126460981	missense	probably benign
R8127:Ago1	UTSW	4	126454421	missense	possibly damaging	0.95
R8772:Ago1	UTSW	4	126460523	unclassified	probably benign
R8878:Ago1	UTSW	4	126463723	missense	probably benign	0.35
R8989:Ago1	UTSW	4	126463790	missense	probably benign	0.01
R9140:Ago1	UTSW	4	126443184	missense	probably benign
X0025:Ago1	UTSW	4	126443115	missense	possibly damaging	0.47
Z1177:Ago1	UTSW	4	126453656	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGTCTCTAGTCTCTGTGCTCATG -3'
(R):5'- ACCAGTGGTCTTGGTCTGAG -3'

Sequencing Primer
(F):5'- GCACATCAGCAAATATTAGACTATGC -3'
(R):5'- TAGGAGACTGCCAGACTCTGTC -3'

Posted On

2019-05-13