Incidental Mutation 'R7041:Rbak'
ID547048
Institutional Source Beutler Lab
Gene Symbol Rbak
Ensembl Gene ENSMUSG00000061898
Gene NameRB-associated KRAB zinc finger
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R7041 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location143172186-143180775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143173471 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 609 (I609N)
Ref Sequence ENSEMBL: ENSMUSP00000128731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049861] [ENSMUST00000165318]
Predicted Effect probably damaging
Transcript: ENSMUST00000049861
AA Change: I609N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059273
Gene: ENSMUSG00000061898
AA Change: I609N

DomainStartEndE-ValueType
KRAB 8 68 6.89e-36 SMART
ZnF_C2H2 258 280 1.1e-2 SMART
ZnF_C2H2 286 308 1.4e-4 SMART
ZnF_C2H2 314 336 5.21e-4 SMART
ZnF_C2H2 342 364 1.95e-3 SMART
ZnF_C2H2 370 392 2.3e-5 SMART
ZnF_C2H2 398 420 3.95e-4 SMART
ZnF_C2H2 426 448 5.59e-4 SMART
ZnF_C2H2 454 476 1.12e-3 SMART
ZnF_C2H2 508 528 1.4e1 SMART
ZnF_C2H2 536 558 3.89e-3 SMART
ZnF_C2H2 564 586 1.04e-3 SMART
ZnF_C2H2 592 614 5.42e-2 SMART
ZnF_C2H2 620 642 1.5e-4 SMART
ZnF_C2H2 648 670 9.22e-5 SMART
ZnF_C2H2 676 698 5.21e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165318
AA Change: I609N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128731
Gene: ENSMUSG00000061898
AA Change: I609N

DomainStartEndE-ValueType
KRAB 8 68 6.89e-36 SMART
ZnF_C2H2 258 280 1.1e-2 SMART
ZnF_C2H2 286 308 1.4e-4 SMART
ZnF_C2H2 314 336 5.21e-4 SMART
ZnF_C2H2 342 364 1.95e-3 SMART
ZnF_C2H2 370 392 2.3e-5 SMART
ZnF_C2H2 398 420 3.95e-4 SMART
ZnF_C2H2 426 448 5.59e-4 SMART
ZnF_C2H2 454 476 1.12e-3 SMART
ZnF_C2H2 508 528 1.4e1 SMART
ZnF_C2H2 536 558 3.89e-3 SMART
ZnF_C2H2 564 586 1.04e-3 SMART
ZnF_C2H2 592 614 5.42e-2 SMART
ZnF_C2H2 620 642 1.5e-4 SMART
ZnF_C2H2 648 670 9.22e-5 SMART
ZnF_C2H2 676 698 5.21e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein which interacts with the tumor suppressor retinoblastoma 1. The two interacting proteins are thought to act as a transcriptional repressor for promoters which are activated by the E2F1 transcription factor. This protein contains a Kruppel-associated box (KRAB), which is a transcriptional repressor motif. Read-through transcripts that include exons from the downstream gene LOC389458 are expressed from this locus. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G T 7: 79,098,348 E956* probably null Het
Adam25 A T 8: 40,754,084 H129L probably benign Het
Adgrl4 A T 3: 151,439,322 H36L probably benign Het
Ago1 T A 4: 126,463,706 I59F possibly damaging Het
Anapc1 A T 2: 128,628,656 V1518E possibly damaging Het
Atxn1 A G 13: 45,566,835 I528T probably damaging Het
B4galnt4 A G 7: 141,070,680 H820R probably damaging Het
Cacna1h T C 17: 25,394,003 E282G probably damaging Het
Camk1 T A 6: 113,339,514 M95L probably benign Het
Capn7 C T 14: 31,336,685 probably benign Het
Cav1 A G 6: 17,339,144 E45G possibly damaging Het
Ccdc183 T G 2: 25,613,670 E185A probably benign Het
Ccl2 T A 11: 82,035,663 M1K probably null Het
Cep97 T A 16: 55,905,754 H590L probably benign Het
Dsg1c A T 18: 20,266,144 I102F probably damaging Het
Fam198a A T 9: 121,965,401 Q207L probably damaging Het
Fcho2 A G 13: 98,784,826 Y184H possibly damaging Het
Gart C T 16: 91,643,143 probably benign Het
Golga3 G A 5: 110,208,584 probably null Het
Hint3 G T 10: 30,610,384 A133E probably damaging Het
Hspe1 T C 1: 55,089,217 probably null Het
Insr A T 8: 3,258,418 V206E probably benign Het
Insrr T C 3: 87,815,244 S1258P probably damaging Het
Itga11 C T 9: 62,752,256 T430M probably damaging Het
Jmjd1c G A 10: 67,220,609 V890I possibly damaging Het
Kdm4b T A 17: 56,396,592 S717R probably damaging Het
Large1 A T 8: 73,116,464 C144S probably damaging Het
Lrat G T 3: 82,903,448 Q89K probably benign Het
Lrrc66 A T 5: 73,608,556 F381L possibly damaging Het
Myo15 A G 11: 60,506,006 T2634A probably damaging Het
Nup205 T G 6: 35,224,535 I1182M possibly damaging Het
Olfr1023 A T 2: 85,887,621 I274F probably benign Het
Olfr435 T A 6: 43,201,903 D86E probably benign Het
Olfr798 T A 10: 129,625,734 E109V probably damaging Het
Plekha6 T A 1: 133,272,460 V259D possibly damaging Het
Prdm9 C A 17: 15,544,995 A508S possibly damaging Het
Prickle2 A G 6: 92,376,305 F783L probably benign Het
Ptprc T C 1: 138,126,309 S31G probably benign Het
Rimklb A T 6: 122,459,217 L134* probably null Het
Ripor2 A G 13: 24,693,766 I250V probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spaca6 C T 17: 17,836,096 L118F probably benign Het
Tmem167 G A 13: 90,098,414 C19Y probably benign Het
Togaram1 C T 12: 65,020,386 T1684I possibly damaging Het
Trappc8 T C 18: 20,874,672 T129A probably benign Het
Ubash3a A G 17: 31,228,210 S347G probably benign Het
Unc80 T C 1: 66,503,593 S289P probably benign Het
Vmn2r11 A G 5: 109,054,950 I87T probably damaging Het
Vmn2r54 A T 7: 12,629,824 F381I probably damaging Het
Wdsub1 A G 2: 59,852,880 L450P probably damaging Het
Xylt2 A G 11: 94,667,582 probably null Het
Zfp429 A T 13: 67,390,711 C205S probably damaging Het
Zfp60 T C 7: 27,749,026 I373T probably benign Het
Zfp738 A G 13: 67,670,301 S524P probably damaging Het
Other mutations in Rbak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01843:Rbak APN 5 143176600 splice site probably benign
R0117:Rbak UTSW 5 143173632 nonsense probably null
R0514:Rbak UTSW 5 143173414 missense probably damaging 0.96
R0945:Rbak UTSW 5 143173579 missense probably damaging 1.00
R1483:Rbak UTSW 5 143174344 missense probably damaging 1.00
R1796:Rbak UTSW 5 143173447 missense probably damaging 1.00
R1916:Rbak UTSW 5 143176116 missense probably damaging 1.00
R1960:Rbak UTSW 5 143174682 nonsense probably null
R2039:Rbak UTSW 5 143173175 missense probably benign 0.37
R2070:Rbak UTSW 5 143176584 missense probably damaging 0.99
R2071:Rbak UTSW 5 143176584 missense probably damaging 0.99
R2151:Rbak UTSW 5 143176502 missense possibly damaging 0.65
R2877:Rbak UTSW 5 143174105 missense probably damaging 1.00
R4030:Rbak UTSW 5 143173969 missense probably damaging 1.00
R4584:Rbak UTSW 5 143176123 missense probably benign 0.00
R4612:Rbak UTSW 5 143174467 missense probably benign 0.01
R5229:Rbak UTSW 5 143174162 missense probably damaging 1.00
R5518:Rbak UTSW 5 143173309 missense probably damaging 1.00
R5541:Rbak UTSW 5 143173990 missense probably damaging 1.00
R5873:Rbak UTSW 5 143173711 missense probably benign 0.32
R5908:Rbak UTSW 5 143173636 missense probably damaging 1.00
R6053:Rbak UTSW 5 143174682 nonsense probably null
R6416:Rbak UTSW 5 143176552 missense possibly damaging 0.67
R6693:Rbak UTSW 5 143174111 missense probably damaging 0.97
R7057:Rbak UTSW 5 143173927 missense possibly damaging 0.81
R7341:Rbak UTSW 5 143176072 missense probably benign 0.01
R7454:Rbak UTSW 5 143173773 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTTGGCATGTCAGAGCTTTTC -3'
(R):5'- GTGCACTACAGAGGTCATTCCG -3'

Sequencing Primer
(F):5'- TCCTGAATGAGTCCGGTAATGCAC -3'
(R):5'- TTCCGAAGAGAAGCCCTTCG -3'
Posted On2019-05-13