Mutagenetix > Incidental Mutation

Incidental Mutation 'R7041:Nup205'

547050

Institutional Source

Beutler Lab

Gene Symbol

Nup205

Ensembl Gene

ENSMUSG00000038759

Gene Name

nucleoporin 205

Synonyms

3830404O05Rik

MMRRC Submission

045140-MU

Accession Numbers

NCBI RefSeq: NM_027513.1; MGI:2141625

Essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R7041 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

35177421-35247596 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 35224535 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 1182 (I1182M)

Ref Sequence

ENSEMBL: ENSMUSP00000039656 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043815] [ENSMUST00000170234] [ENSMUST00000201374]

AlphaFold

A0A0J9YUD5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043815
AA Change: I1182M

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000039656
Gene: ENSMUSG00000038759
AA Change: I1182M

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
Pfam:Nup192	14	1684	N/A	PFAM
low complexity region	1995	2005	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170234

SMART Domains

Protein: ENSMUSP00000130033
Gene: ENSMUSG00000038759

Domain	Start	End	E-Value	Type
Pfam:DUF3414	13	322	9.7e-98	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000201374
AA Change: I1235M

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000144126
Gene: ENSMUSG00000038759
AA Change: I1235M

Domain	Start	End	E-Value	Type
low complexity region	36	50	N/A	INTRINSIC
Pfam:Nup192	67	1737	N/A	PFAM
low complexity region	2048	2058	N/A	INTRINSIC

Meta Mutation Damage Score

0.0888

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleoporin, which is a subunit of the nuclear pore complex that functions in active transport of proteins, RNAs and ribonucleoprotein particles between the nucleus and cytoplasm. Mutations in this gene are associated with steroid-resistant nephrotic syndrome. [provided by RefSeq, Jul 2016]

Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	G	T	7: 79,098,348	E956*	probably null	Het
Adam25	A	T	8: 40,754,084	H129L	probably benign	Het
Adgrl4	A	T	3: 151,439,322	H36L	probably benign	Het
Ago1	T	A	4: 126,463,706	I59F	possibly damaging	Het
Anapc1	A	T	2: 128,628,656	V1518E	possibly damaging	Het
Atxn1	A	G	13: 45,566,835	I528T	probably damaging	Het
B4galnt4	A	G	7: 141,070,680	H820R	probably damaging	Het
Cacna1h	T	C	17: 25,394,003	E282G	probably damaging	Het
Camk1	T	A	6: 113,339,514	M95L	probably benign	Het
Capn7	C	T	14: 31,336,685		probably benign	Het
Cav1	A	G	6: 17,339,144	E45G	possibly damaging	Het
Ccdc183	T	G	2: 25,613,670	E185A	probably benign	Het
Ccl2	T	A	11: 82,035,663	M1K	probably null	Het
Cep97	T	A	16: 55,905,754	H590L	probably benign	Het
Dsg1c	A	T	18: 20,266,144	I102F	probably damaging	Het
Fam198a	A	T	9: 121,965,401	Q207L	probably damaging	Het
Fcho2	A	G	13: 98,784,826	Y184H	possibly damaging	Het
Gart	C	T	16: 91,643,143		probably benign	Het
Golga3	G	A	5: 110,208,584		probably null	Het
Hint3	G	T	10: 30,610,384	A133E	probably damaging	Het
Hspe1	T	C	1: 55,089,217		probably null	Het
Insr	A	T	8: 3,258,418	V206E	probably benign	Het
Insrr	T	C	3: 87,815,244	S1258P	probably damaging	Het
Itga11	C	T	9: 62,752,256	T430M	probably damaging	Het
Jmjd1c	G	A	10: 67,220,609	V890I	possibly damaging	Het
Kdm4b	T	A	17: 56,396,592	S717R	probably damaging	Het
Large1	A	T	8: 73,116,464	C144S	probably damaging	Het
Lrat	G	T	3: 82,903,448	Q89K	probably benign	Het
Lrrc66	A	T	5: 73,608,556	F381L	possibly damaging	Het
Myo15	A	G	11: 60,506,006	T2634A	probably damaging	Het
Olfr1023	A	T	2: 85,887,621	I274F	probably benign	Het
Olfr435	T	A	6: 43,201,903	D86E	probably benign	Het
Olfr798	T	A	10: 129,625,734	E109V	probably damaging	Het
Plekha6	T	A	1: 133,272,460	V259D	possibly damaging	Het
Prdm9	C	A	17: 15,544,995	A508S	possibly damaging	Het
Prickle2	A	G	6: 92,376,305	F783L	probably benign	Het
Ptprc	T	C	1: 138,126,309	S31G	probably benign	Het
Rbak	A	T	5: 143,173,471	I609N	probably damaging	Het
Rimklb	A	T	6: 122,459,217	L134*	probably null	Het
Ripor2	A	G	13: 24,693,766	I250V	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Spaca6	C	T	17: 17,836,096	L118F	probably benign	Het
Tmem167	G	A	13: 90,098,414	C19Y	probably benign	Het
Togaram1	C	T	12: 65,020,386	T1684I	possibly damaging	Het
Trappc8	T	C	18: 20,874,672	T129A	probably benign	Het
Ubash3a	A	G	17: 31,228,210	S347G	probably benign	Het
Unc80	T	C	1: 66,503,593	S289P	probably benign	Het
Vmn2r11	A	G	5: 109,054,950	I87T	probably damaging	Het
Vmn2r54	A	T	7: 12,629,824	F381I	probably damaging	Het
Wdsub1	A	G	2: 59,852,880	L450P	probably damaging	Het
Xylt2	A	G	11: 94,667,582		probably null	Het
Zfp429	A	T	13: 67,390,711	C205S	probably damaging	Het
Zfp60	T	C	7: 27,749,026	I373T	probably benign	Het
Zfp738	A	G	13: 67,670,301	S524P	probably damaging	Het

Other mutations in Nup205

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Nup205	APN	6	35214802	missense	probably damaging	1.00
IGL01086:Nup205	APN	6	35208936	splice site	probably benign
IGL01138:Nup205	APN	6	35208084	nonsense	probably null
IGL01333:Nup205	APN	6	35241063	missense	probably benign
IGL01399:Nup205	APN	6	35219689	missense	possibly damaging	0.80
IGL01466:Nup205	APN	6	35199959	missense	probably benign	0.08
IGL01913:Nup205	APN	6	35227430	missense	probably benign	0.10
IGL02159:Nup205	APN	6	35189178	missense	probably damaging	1.00
IGL02442:Nup205	APN	6	35190068	missense	probably benign	0.01
IGL02447:Nup205	APN	6	35227576	splice site	probably null
IGL02558:Nup205	APN	6	35189924	missense	probably damaging	1.00
IGL03306:Nup205	APN	6	35208169	missense	probably damaging	0.98
IGL03328:Nup205	APN	6	35232414	missense	probably damaging	0.99
Figaro	UTSW	6	35196714	splice site	probably null
Marcellina	UTSW	6	35183969	missense	probably damaging	1.00
Spirit	UTSW	6	35232408	missense	probably damaging	0.98
Susanna	UTSW	6	35208109	missense	possibly damaging	0.94
voyager	UTSW	6	35189885	missense	possibly damaging	0.80
BB007:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
BB017:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
P0012:Nup205	UTSW	6	35196543	missense	possibly damaging	0.90
R0102:Nup205	UTSW	6	35225780	splice site	probably benign
R0102:Nup205	UTSW	6	35225780	splice site	probably benign
R0362:Nup205	UTSW	6	35196714	splice site	probably null
R0374:Nup205	UTSW	6	35208837	missense	probably damaging	1.00
R0415:Nup205	UTSW	6	35214634	splice site	probably benign
R0427:Nup205	UTSW	6	35194463	missense	probably benign	0.01
R0543:Nup205	UTSW	6	35198969	missense	probably benign
R0611:Nup205	UTSW	6	35225968	missense	probably null	1.00
R0761:Nup205	UTSW	6	35196428	splice site	probably benign
R0828:Nup205	UTSW	6	35194566	missense	probably benign
R0906:Nup205	UTSW	6	35236892	missense	probably damaging	1.00
R1023:Nup205	UTSW	6	35234706	missense	probably damaging	0.98
R1033:Nup205	UTSW	6	35227442	missense	probably benign
R1375:Nup205	UTSW	6	35200071	splice site	probably benign
R1447:Nup205	UTSW	6	35215185	missense	probably benign	0.00
R1468:Nup205	UTSW	6	35225982	critical splice donor site	probably null
R1468:Nup205	UTSW	6	35225982	critical splice donor site	probably null
R1625:Nup205	UTSW	6	35191943	missense	probably benign	0.31
R1652:Nup205	UTSW	6	35238966	missense	probably benign
R1659:Nup205	UTSW	6	35234788	missense	probably benign	0.02
R1693:Nup205	UTSW	6	35210971	missense	probably benign	0.05
R1769:Nup205	UTSW	6	35205431	missense	probably damaging	1.00
R1839:Nup205	UTSW	6	35219714	missense	probably benign	0.00
R1959:Nup205	UTSW	6	35233366	missense	probably benign	0.16
R2051:Nup205	UTSW	6	35230516	missense	probably benign	0.29
R2267:Nup205	UTSW	6	35241349	missense	possibly damaging	0.67
R2401:Nup205	UTSW	6	35208134	nonsense	probably null
R3697:Nup205	UTSW	6	35188711	missense	probably benign	0.15
R3938:Nup205	UTSW	6	35219742	missense	probably damaging	1.00
R4074:Nup205	UTSW	6	35192040	critical splice donor site	probably null
R4117:Nup205	UTSW	6	35241012	nonsense	probably null
R4364:Nup205	UTSW	6	35192027	missense	probably benign	0.38
R4366:Nup205	UTSW	6	35192027	missense	probably benign	0.38
R4594:Nup205	UTSW	6	35196489	missense	probably benign	0.00
R4706:Nup205	UTSW	6	35202008	missense	probably damaging	1.00
R4787:Nup205	UTSW	6	35202061	missense	probably damaging	1.00
R4849:Nup205	UTSW	6	35230570	missense	possibly damaging	0.90
R4850:Nup205	UTSW	6	35230530	missense	probably benign	0.16
R4943:Nup205	UTSW	6	35224639	missense	probably damaging	1.00
R4966:Nup205	UTSW	6	35243849	missense	probably benign	0.00
R5138:Nup205	UTSW	6	35225866	missense	probably damaging	1.00
R5251:Nup205	UTSW	6	35196482	splice site	probably null
R5444:Nup205	UTSW	6	35189189	missense	probably damaging	0.98
R5760:Nup205	UTSW	6	35247343	missense	probably damaging	1.00
R5762:Nup205	UTSW	6	35227680	missense	probably damaging	1.00
R5762:Nup205	UTSW	6	35230548	missense	probably damaging	0.96
R5941:Nup205	UTSW	6	35232408	missense	probably damaging	0.98
R5969:Nup205	UTSW	6	35177578	unclassified	probably benign
R6003:Nup205	UTSW	6	35212816	missense	probably benign
R6178:Nup205	UTSW	6	35243843	missense	possibly damaging	0.85
R6315:Nup205	UTSW	6	35236869	missense	probably damaging	1.00
R6392:Nup205	UTSW	6	35189885	missense	possibly damaging	0.80
R6710:Nup205	UTSW	6	35247373	missense	probably benign	0.00
R6954:Nup205	UTSW	6	35208109	missense	possibly damaging	0.94
R7022:Nup205	UTSW	6	35243936	missense	probably benign	0.45
R7052:Nup205	UTSW	6	35215142	missense	possibly damaging	0.81
R7310:Nup205	UTSW	6	35225969	missense	possibly damaging	0.78
R7363:Nup205	UTSW	6	35232573	missense	probably benign	0.28
R7399:Nup205	UTSW	6	35214676	missense	probably damaging	0.99
R7428:Nup205	UTSW	6	35227559	missense	probably damaging	1.00
R7553:Nup205	UTSW	6	35201999	missense	probably damaging	1.00
R7665:Nup205	UTSW	6	35177620	missense	possibly damaging	0.46
R7841:Nup205	UTSW	6	35247437	missense	unknown
R7930:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
R7973:Nup205	UTSW	6	35245339	missense	probably benign
R7976:Nup205	UTSW	6	35198953	missense	probably damaging	1.00
R8073:Nup205	UTSW	6	35202169	critical splice donor site	probably null
R8080:Nup205	UTSW	6	35227376	missense	probably damaging	1.00
R8118:Nup205	UTSW	6	35230516	missense	probably benign	0.29
R8213:Nup205	UTSW	6	35225203	missense	probably benign	0.26
R8237:Nup205	UTSW	6	35227503	missense	possibly damaging	0.89
R8408:Nup205	UTSW	6	35225247	missense	probably damaging	1.00
R8807:Nup205	UTSW	6	35183969	missense	probably damaging	1.00
R8812:Nup205	UTSW	6	35214334	missense	probably damaging	1.00
R9061:Nup205	UTSW	6	35219873	intron	probably benign
R9261:Nup205	UTSW	6	35199857	missense	probably benign	0.00
R9403:Nup205	UTSW	6	35199974	missense	probably benign	0.45
R9648:Nup205	UTSW	6	35225811	missense	probably benign	0.00
R9744:Nup205	UTSW	6	35232575	missense	probably damaging	0.99
R9800:Nup205	UTSW	6	35186533	missense	possibly damaging	0.85
Z1177:Nup205	UTSW	6	35177605	missense	unknown
Z1177:Nup205	UTSW	6	35208793	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTGTCTCTAGGTTCTGGAACTATATAG -3'
(R):5'- CAGCTTGGTGTGTGAAGCAG -3'

Sequencing Primer
(F):5'- TAGGTTCTGGAACTATATAGAAGAGC -3'
(R):5'- AGTCACTGCAGGCTCGTGAG -3'

Posted On

2019-05-13