Incidental Mutation 'R7041:Acan'
ID547057
Institutional Source Beutler Lab
Gene Symbol Acan
Ensembl Gene ENSMUSG00000030607
Gene Nameaggrecan
SynonymsAgc1, b2b183Clo, Cspg1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7041 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location79053483-79115099 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 79098348 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 956 (E956*)
Ref Sequence ENSEMBL: ENSMUSP00000032835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032835]
Predicted Effect probably null
Transcript: ENSMUST00000032835
AA Change: E956*
SMART Domains Protein: ENSMUSP00000032835
Gene: ENSMUSG00000030607
AA Change: E956*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 46 135 3.46e-7 SMART
LINK 151 248 1.76e-59 SMART
LINK 252 350 4.13e-65 SMART
LINK 485 582 1.03e-51 SMART
LINK 586 684 9.58e-61 SMART
low complexity region 767 794 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 890 904 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1707 1720 N/A INTRINSIC
low complexity region 1808 1823 N/A INTRINSIC
low complexity region 1904 1915 N/A INTRINSIC
CLECT 1922 2043 2.13e-37 SMART
CCP 2049 2105 9.32e-11 SMART
low complexity region 2118 2130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206779
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (53/55)
MGI Phenotype PHENOTYPE: Spontaneous mutations in this gene lead to dwarfism, cartilage, skeletal and limb anomalies, craniofacial defects, hearing loss and neonatal death due to respiratory failure. Homozygotes for an ENU-induced allele show cardiomyopathy as well as cleft palate, disproportionate dwarfism and brachypodia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A T 8: 40,754,084 H129L probably benign Het
Adgrl4 A T 3: 151,439,322 H36L probably benign Het
Ago1 T A 4: 126,463,706 I59F possibly damaging Het
Anapc1 A T 2: 128,628,656 V1518E possibly damaging Het
Atxn1 A G 13: 45,566,835 I528T probably damaging Het
B4galnt4 A G 7: 141,070,680 H820R probably damaging Het
Cacna1h T C 17: 25,394,003 E282G probably damaging Het
Camk1 T A 6: 113,339,514 M95L probably benign Het
Capn7 C T 14: 31,336,685 probably benign Het
Cav1 A G 6: 17,339,144 E45G possibly damaging Het
Ccdc183 T G 2: 25,613,670 E185A probably benign Het
Ccl2 T A 11: 82,035,663 M1K probably null Het
Cep97 T A 16: 55,905,754 H590L probably benign Het
Dsg1c A T 18: 20,266,144 I102F probably damaging Het
Fam198a A T 9: 121,965,401 Q207L probably damaging Het
Fcho2 A G 13: 98,784,826 Y184H possibly damaging Het
Gart C T 16: 91,643,143 probably benign Het
Golga3 G A 5: 110,208,584 probably null Het
Hint3 G T 10: 30,610,384 A133E probably damaging Het
Hspe1 T C 1: 55,089,217 probably null Het
Insr A T 8: 3,258,418 V206E probably benign Het
Insrr T C 3: 87,815,244 S1258P probably damaging Het
Itga11 C T 9: 62,752,256 T430M probably damaging Het
Jmjd1c G A 10: 67,220,609 V890I possibly damaging Het
Kdm4b T A 17: 56,396,592 S717R probably damaging Het
Large1 A T 8: 73,116,464 C144S probably damaging Het
Lrat G T 3: 82,903,448 Q89K probably benign Het
Lrrc66 A T 5: 73,608,556 F381L possibly damaging Het
Myo15 A G 11: 60,506,006 T2634A probably damaging Het
Nup205 T G 6: 35,224,535 I1182M possibly damaging Het
Olfr1023 A T 2: 85,887,621 I274F probably benign Het
Olfr435 T A 6: 43,201,903 D86E probably benign Het
Olfr798 T A 10: 129,625,734 E109V probably damaging Het
Plekha6 T A 1: 133,272,460 V259D possibly damaging Het
Prdm9 C A 17: 15,544,995 A508S possibly damaging Het
Prickle2 A G 6: 92,376,305 F783L probably benign Het
Ptprc T C 1: 138,126,309 S31G probably benign Het
Rbak A T 5: 143,173,471 I609N probably damaging Het
Rimklb A T 6: 122,459,217 L134* probably null Het
Ripor2 A G 13: 24,693,766 I250V probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spaca6 C T 17: 17,836,096 L118F probably benign Het
Tmem167 G A 13: 90,098,414 C19Y probably benign Het
Togaram1 C T 12: 65,020,386 T1684I possibly damaging Het
Trappc8 T C 18: 20,874,672 T129A probably benign Het
Ubash3a A G 17: 31,228,210 S347G probably benign Het
Unc80 T C 1: 66,503,593 S289P probably benign Het
Vmn2r11 A G 5: 109,054,950 I87T probably damaging Het
Vmn2r54 A T 7: 12,629,824 F381I probably damaging Het
Wdsub1 A G 2: 59,852,880 L450P probably damaging Het
Xylt2 A G 11: 94,667,582 probably null Het
Zfp429 A T 13: 67,390,711 C205S probably damaging Het
Zfp60 T C 7: 27,749,026 I373T probably benign Het
Zfp738 A G 13: 67,670,301 S524P probably damaging Het
Other mutations in Acan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Acan APN 7 79097824 missense probably benign 0.00
IGL01118:Acan APN 7 79098653 missense possibly damaging 0.78
IGL01145:Acan APN 7 79099282 missense probably damaging 1.00
IGL01308:Acan APN 7 79099249 missense probably damaging 0.98
IGL01520:Acan APN 7 79084570 missense probably damaging 0.96
IGL02069:Acan APN 7 79092752 missense possibly damaging 0.83
IGL02629:Acan APN 7 79111979 missense possibly damaging 0.90
IGL02713:Acan APN 7 79100244 missense possibly damaging 0.90
IGL03001:Acan APN 7 79111294 missense probably damaging 0.99
IGL03081:Acan APN 7 79098543 missense probably benign 0.01
Hollowleg UTSW 7 79098348 nonsense probably null
Vacuo UTSW 7 79088307 critical splice donor site probably null
IGL03147:Acan UTSW 7 79091056 missense probably damaging 1.00
R0281:Acan UTSW 7 79100285 missense probably damaging 1.00
R0372:Acan UTSW 7 79100601 missense probably benign 0.00
R0599:Acan UTSW 7 79111290 splice site probably benign
R0827:Acan UTSW 7 79099671 missense probably benign 0.00
R0835:Acan UTSW 7 79114232 missense probably damaging 0.96
R1496:Acan UTSW 7 79100804 missense probably benign 0.06
R1716:Acan UTSW 7 79082198 missense unknown
R1761:Acan UTSW 7 79094085 nonsense probably null
R1848:Acan UTSW 7 79099035 missense probably benign
R2002:Acan UTSW 7 79100793 missense probably damaging 1.00
R2025:Acan UTSW 7 79101222 missense probably benign
R2167:Acan UTSW 7 79099957 missense probably benign 0.41
R2189:Acan UTSW 7 79098091 missense probably damaging 1.00
R2303:Acan UTSW 7 79099957 missense probably benign 0.41
R2496:Acan UTSW 7 79111317 missense probably damaging 1.00
R2971:Acan UTSW 7 79099699 missense possibly damaging 0.46
R4004:Acan UTSW 7 79100687 missense probably damaging 1.00
R4669:Acan UTSW 7 79101142 missense probably benign 0.01
R4732:Acan UTSW 7 79098609 missense probably damaging 0.99
R4733:Acan UTSW 7 79098609 missense probably damaging 0.99
R4742:Acan UTSW 7 79100769 missense probably benign 0.41
R4750:Acan UTSW 7 79092718 missense probably damaging 1.00
R5022:Acan UTSW 7 79092808 critical splice donor site probably null
R5122:Acan UTSW 7 79100661 missense probably damaging 0.99
R5190:Acan UTSW 7 79098541 missense probably benign 0.03
R5220:Acan UTSW 7 79088297 missense probably damaging 0.96
R5414:Acan UTSW 7 79100988 missense probably benign 0.00
R5525:Acan UTSW 7 79099983 missense probably benign
R5655:Acan UTSW 7 79100043 missense possibly damaging 0.89
R5662:Acan UTSW 7 79100107 missense possibly damaging 0.78
R5748:Acan UTSW 7 79089699 missense probably damaging 0.98
R5758:Acan UTSW 7 79101214 missense possibly damaging 0.67
R5996:Acan UTSW 7 79111320 missense probably damaging 0.97
R6057:Acan UTSW 7 79099782 missense probably null
R6503:Acan UTSW 7 79097832 missense probably benign 0.04
R6529:Acan UTSW 7 79089731 missense probably benign 0.16
R6887:Acan UTSW 7 79092483 missense probably damaging 1.00
R7193:Acan UTSW 7 79086342 missense probably damaging 1.00
R7220:Acan UTSW 7 79108148 missense
R7263:Acan UTSW 7 79092318 missense probably damaging 0.98
R7376:Acan UTSW 7 79088307 critical splice donor site probably null
R7502:Acan UTSW 7 79094203 missense probably damaging 1.00
R7571:Acan UTSW 7 79086267 missense probably damaging 1.00
R7709:Acan UTSW 7 79089608 missense probably damaging 1.00
Z1088:Acan UTSW 7 79088200 nonsense probably null
Z1088:Acan UTSW 7 79100110 missense probably benign 0.41
Z1088:Acan UTSW 7 79111354 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGCCTCAGGAGATGGAGAAG -3'
(R):5'- GAAGTCCACTCAAGTCTCCC -3'

Sequencing Primer
(F):5'- ATACTCCCACAGTTGGCAGGTTG -3'
(R):5'- CACTCCAGAAGCAGAGGTTTCTAG -3'
Posted On2019-05-13