Incidental Mutation 'R7041:Olfr798'
ID547066
Institutional Source Beutler Lab
Gene Symbol Olfr798
Ensembl Gene ENSMUSG00000095002
Gene Nameolfactory receptor 798
SynonymsGA_x6K02T2PULF-11304679-11303744, MOR108-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R7041 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location129622615-129627934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129625734 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 109 (E109V)
Ref Sequence ENSEMBL: ENSMUSP00000144716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079810] [ENSMUST00000204979]
Predicted Effect probably damaging
Transcript: ENSMUST00000079810
AA Change: E109V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078739
Gene: ENSMUSG00000095002
AA Change: E109V

DomainStartEndE-ValueType
Pfam:7tm_4 28 309 5e-52 PFAM
Pfam:7tm_1 39 288 2.1e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204979
AA Change: E109V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144716
Gene: ENSMUSG00000095002
AA Change: E109V

DomainStartEndE-ValueType
Pfam:7tm_4 28 309 5e-52 PFAM
Pfam:7tm_1 39 288 2.1e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G T 7: 79,098,348 E956* probably null Het
Adam25 A T 8: 40,754,084 H129L probably benign Het
Adgrl4 A T 3: 151,439,322 H36L probably benign Het
Ago1 T A 4: 126,463,706 I59F possibly damaging Het
Anapc1 A T 2: 128,628,656 V1518E possibly damaging Het
Atxn1 A G 13: 45,566,835 I528T probably damaging Het
B4galnt4 A G 7: 141,070,680 H820R probably damaging Het
Cacna1h T C 17: 25,394,003 E282G probably damaging Het
Camk1 T A 6: 113,339,514 M95L probably benign Het
Capn7 C T 14: 31,336,685 probably benign Het
Cav1 A G 6: 17,339,144 E45G possibly damaging Het
Ccdc183 T G 2: 25,613,670 E185A probably benign Het
Ccl2 T A 11: 82,035,663 M1K probably null Het
Cep97 T A 16: 55,905,754 H590L probably benign Het
Dsg1c A T 18: 20,266,144 I102F probably damaging Het
Fam198a A T 9: 121,965,401 Q207L probably damaging Het
Fcho2 A G 13: 98,784,826 Y184H possibly damaging Het
Gart C T 16: 91,643,143 probably benign Het
Golga3 G A 5: 110,208,584 probably null Het
Hint3 G T 10: 30,610,384 A133E probably damaging Het
Hspe1 T C 1: 55,089,217 probably null Het
Insr A T 8: 3,258,418 V206E probably benign Het
Insrr T C 3: 87,815,244 S1258P probably damaging Het
Itga11 C T 9: 62,752,256 T430M probably damaging Het
Jmjd1c G A 10: 67,220,609 V890I possibly damaging Het
Kdm4b T A 17: 56,396,592 S717R probably damaging Het
Large1 A T 8: 73,116,464 C144S probably damaging Het
Lrat G T 3: 82,903,448 Q89K probably benign Het
Lrrc66 A T 5: 73,608,556 F381L possibly damaging Het
Myo15 A G 11: 60,506,006 T2634A probably damaging Het
Nup205 T G 6: 35,224,535 I1182M possibly damaging Het
Olfr1023 A T 2: 85,887,621 I274F probably benign Het
Olfr435 T A 6: 43,201,903 D86E probably benign Het
Plekha6 T A 1: 133,272,460 V259D possibly damaging Het
Prdm9 C A 17: 15,544,995 A508S possibly damaging Het
Prickle2 A G 6: 92,376,305 F783L probably benign Het
Ptprc T C 1: 138,126,309 S31G probably benign Het
Rbak A T 5: 143,173,471 I609N probably damaging Het
Rimklb A T 6: 122,459,217 L134* probably null Het
Ripor2 A G 13: 24,693,766 I250V probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spaca6 C T 17: 17,836,096 L118F probably benign Het
Tmem167 G A 13: 90,098,414 C19Y probably benign Het
Togaram1 C T 12: 65,020,386 T1684I possibly damaging Het
Trappc8 T C 18: 20,874,672 T129A probably benign Het
Ubash3a A G 17: 31,228,210 S347G probably benign Het
Unc80 T C 1: 66,503,593 S289P probably benign Het
Vmn2r11 A G 5: 109,054,950 I87T probably damaging Het
Vmn2r54 A T 7: 12,629,824 F381I probably damaging Het
Wdsub1 A G 2: 59,852,880 L450P probably damaging Het
Xylt2 A G 11: 94,667,582 probably null Het
Zfp429 A T 13: 67,390,711 C205S probably damaging Het
Zfp60 T C 7: 27,749,026 I373T probably benign Het
Zfp738 A G 13: 67,670,301 S524P probably damaging Het
Other mutations in Olfr798
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Olfr798 APN 10 129625563 missense probably damaging 1.00
IGL02866:Olfr798 APN 10 129625706 nonsense probably null
R0743:Olfr798 UTSW 10 129625843 missense probably benign 0.03
R1163:Olfr798 UTSW 10 129625647 missense possibly damaging 0.79
R1192:Olfr798 UTSW 10 129626037 missense probably benign
R1863:Olfr798 UTSW 10 129625348 missense probably damaging 0.96
R1867:Olfr798 UTSW 10 129625752 missense probably damaging 0.99
R2508:Olfr798 UTSW 10 129625915 missense probably benign
R4898:Olfr798 UTSW 10 129625599 missense probably benign 0.12
R4910:Olfr798 UTSW 10 129625807 missense probably damaging 0.98
R4988:Olfr798 UTSW 10 129626061 unclassified probably null
R5361:Olfr798 UTSW 10 129625732 missense probably damaging 1.00
R5382:Olfr798 UTSW 10 129626007 missense probably damaging 0.98
R5589:Olfr798 UTSW 10 129625450 missense probably damaging 1.00
R5693:Olfr798 UTSW 10 129625527 missense probably damaging 0.99
R5790:Olfr798 UTSW 10 129625888 missense probably damaging 1.00
R6966:Olfr798 UTSW 10 129625764 missense probably benign 0.17
R7082:Olfr798 UTSW 10 129625765 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GTCACAGAAATCCAGTTGAAGGC -3'
(R):5'- TGAGCATTACTGGAAATCTGACC -3'

Sequencing Primer
(F):5'- TCCAGTTGAAGGCCCATGATC -3'
(R):5'- CTGGAAATCTGACCATTATTACCC -3'
Posted On2019-05-13