Incidental Mutation 'R7041:Zfp429'
ID547073
Institutional Source Beutler Lab
Gene Symbol Zfp429
Ensembl Gene ENSMUSG00000078994
Gene Namezinc finger protein 429
Synonyms2810487A22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7041 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location67387905-67399819 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67390711 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 205 (C205S)
Ref Sequence ENSEMBL: ENSMUSP00000105354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109732] [ENSMUST00000181071] [ENSMUST00000224684] [ENSMUST00000224825]
Predicted Effect probably damaging
Transcript: ENSMUST00000109732
AA Change: C205S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105354
Gene: ENSMUSG00000078994
AA Change: C205S

DomainStartEndE-ValueType
KRAB 15 75 7.16e-34 SMART
ZnF_C2H2 119 141 5.12e1 SMART
ZnF_C2H2 147 169 2.27e-4 SMART
ZnF_C2H2 175 197 1.28e-3 SMART
ZnF_C2H2 203 225 1.56e-2 SMART
ZnF_C2H2 259 281 4.62e1 SMART
ZnF_C2H2 287 309 5.14e-3 SMART
ZnF_C2H2 315 337 6.78e-3 SMART
ZnF_C2H2 343 365 3.11e-2 SMART
ZnF_C2H2 371 393 1.25e-1 SMART
ZnF_C2H2 399 421 6.32e-3 SMART
ZnF_C2H2 427 449 1.47e-3 SMART
ZnF_C2H2 455 477 5.42e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181071
SMART Domains Protein: ENSMUSP00000137755
Gene: ENSMUSG00000078994

DomainStartEndE-ValueType
KRAB 15 75 7.16e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224684
Predicted Effect probably benign
Transcript: ENSMUST00000224825
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G T 7: 79,098,348 E956* probably null Het
Adam25 A T 8: 40,754,084 H129L probably benign Het
Adgrl4 A T 3: 151,439,322 H36L probably benign Het
Ago1 T A 4: 126,463,706 I59F possibly damaging Het
Anapc1 A T 2: 128,628,656 V1518E possibly damaging Het
Atxn1 A G 13: 45,566,835 I528T probably damaging Het
B4galnt4 A G 7: 141,070,680 H820R probably damaging Het
Cacna1h T C 17: 25,394,003 E282G probably damaging Het
Camk1 T A 6: 113,339,514 M95L probably benign Het
Capn7 C T 14: 31,336,685 probably benign Het
Cav1 A G 6: 17,339,144 E45G possibly damaging Het
Ccdc183 T G 2: 25,613,670 E185A probably benign Het
Ccl2 T A 11: 82,035,663 M1K probably null Het
Cep97 T A 16: 55,905,754 H590L probably benign Het
Dsg1c A T 18: 20,266,144 I102F probably damaging Het
Fam198a A T 9: 121,965,401 Q207L probably damaging Het
Fcho2 A G 13: 98,784,826 Y184H possibly damaging Het
Gart C T 16: 91,643,143 probably benign Het
Golga3 G A 5: 110,208,584 probably null Het
Hint3 G T 10: 30,610,384 A133E probably damaging Het
Hspe1 T C 1: 55,089,217 probably null Het
Insr A T 8: 3,258,418 V206E probably benign Het
Insrr T C 3: 87,815,244 S1258P probably damaging Het
Itga11 C T 9: 62,752,256 T430M probably damaging Het
Jmjd1c G A 10: 67,220,609 V890I possibly damaging Het
Kdm4b T A 17: 56,396,592 S717R probably damaging Het
Large1 A T 8: 73,116,464 C144S probably damaging Het
Lrat G T 3: 82,903,448 Q89K probably benign Het
Lrrc66 A T 5: 73,608,556 F381L possibly damaging Het
Myo15 A G 11: 60,506,006 T2634A probably damaging Het
Nup205 T G 6: 35,224,535 I1182M possibly damaging Het
Olfr1023 A T 2: 85,887,621 I274F probably benign Het
Olfr435 T A 6: 43,201,903 D86E probably benign Het
Olfr798 T A 10: 129,625,734 E109V probably damaging Het
Plekha6 T A 1: 133,272,460 V259D possibly damaging Het
Prdm9 C A 17: 15,544,995 A508S possibly damaging Het
Prickle2 A G 6: 92,376,305 F783L probably benign Het
Ptprc T C 1: 138,126,309 S31G probably benign Het
Rbak A T 5: 143,173,471 I609N probably damaging Het
Rimklb A T 6: 122,459,217 L134* probably null Het
Ripor2 A G 13: 24,693,766 I250V probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spaca6 C T 17: 17,836,096 L118F probably benign Het
Tmem167 G A 13: 90,098,414 C19Y probably benign Het
Togaram1 C T 12: 65,020,386 T1684I possibly damaging Het
Trappc8 T C 18: 20,874,672 T129A probably benign Het
Ubash3a A G 17: 31,228,210 S347G probably benign Het
Unc80 T C 1: 66,503,593 S289P probably benign Het
Vmn2r11 A G 5: 109,054,950 I87T probably damaging Het
Vmn2r54 A T 7: 12,629,824 F381I probably damaging Het
Wdsub1 A G 2: 59,852,880 L450P probably damaging Het
Xylt2 A G 11: 94,667,582 probably null Het
Zfp60 T C 7: 27,749,026 I373T probably benign Het
Zfp738 A G 13: 67,670,301 S524P probably damaging Het
Other mutations in Zfp429
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Zfp429 APN 13 67391013 missense probably damaging 0.96
IGL01913:Zfp429 APN 13 67396674 missense probably damaging 1.00
IGL02343:Zfp429 APN 13 67390725 missense probably damaging 0.98
IGL02679:Zfp429 APN 13 67399736 intron probably benign
IGL03396:Zfp429 APN 13 67396040 splice site probably benign
FR4342:Zfp429 UTSW 13 67396650 missense probably benign 0.02
R0012:Zfp429 UTSW 13 67390677 missense probably benign 0.01
R1232:Zfp429 UTSW 13 67390632 missense possibly damaging 0.47
R1330:Zfp429 UTSW 13 67396143 splice site probably null
R1653:Zfp429 UTSW 13 67389924 missense possibly damaging 0.87
R1761:Zfp429 UTSW 13 67396076 missense probably benign 0.28
R1813:Zfp429 UTSW 13 67390386 missense possibly damaging 0.55
R2356:Zfp429 UTSW 13 67390627 missense probably benign
R4280:Zfp429 UTSW 13 67390795 missense probably damaging 1.00
R4283:Zfp429 UTSW 13 67390795 missense probably damaging 1.00
R4464:Zfp429 UTSW 13 67390498 missense probably benign 0.13
R4789:Zfp429 UTSW 13 67390404 missense probably benign 0.06
R5187:Zfp429 UTSW 13 67390840 missense probably damaging 0.99
R5250:Zfp429 UTSW 13 67390519 missense probably benign 0.00
R6688:Zfp429 UTSW 13 67396130 missense probably damaging 0.98
R6772:Zfp429 UTSW 13 67390198 missense probably damaging 1.00
R6989:Zfp429 UTSW 13 67389961 missense probably benign 0.00
R7101:Zfp429 UTSW 13 67390812 missense possibly damaging 0.88
R7593:Zfp429 UTSW 13 67390291 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACAGTCTTCACACTTGT -3'
(R):5'- TGGCTCAACAGGAATAACACC -3'

Sequencing Primer
(F):5'- GGAATAGCATTTGCCACAGTC -3'
(R):5'- CCCTACAAGTGTGGAGAATTTGG -3'
Posted On2019-05-13