Incidental Mutation 'R7041:Sorbs1'
ID547087
Institutional Source Beutler Lab
Gene Symbol Sorbs1
Ensembl Gene ENSMUSG00000025006
Gene Namesorbin and SH3 domain containing 1
Synonyms9530001P15Rik, 2310065E01Rik, Ponsin, Sh3d5, CAP, c-Cbl-associated protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.723) question?
Stock #R7041 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location40294753-40513779 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 40376800 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 180 (R180G)
Ref Sequence ENSEMBL: ENSMUSP00000153313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099466] [ENSMUST00000099467] [ENSMUST00000165212] [ENSMUST00000165469] [ENSMUST00000224233] [ENSMUST00000224247] [ENSMUST00000224583] [ENSMUST00000224667] [ENSMUST00000225148] [ENSMUST00000225153] [ENSMUST00000225786] [ENSMUST00000226047]
Predicted Effect probably benign
Transcript: ENSMUST00000099466
SMART Domains Protein: ENSMUSP00000097065
Gene: ENSMUSG00000025006

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
Sorb 203 249 1.07e-26 SMART
SH3 502 557 2.72e-18 SMART
SH3 576 633 9.32e-17 SMART
low complexity region 647 660 N/A INTRINSIC
SH3 682 739 3.7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099467
AA Change: R180G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097066
Gene: ENSMUSG00000025006
AA Change: R180G

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
low complexity region 192 213 N/A INTRINSIC
Sorb 327 373 1.24e-22 SMART
coiled coil region 558 584 N/A INTRINSIC
SH3 700 755 2.72e-18 SMART
SH3 774 831 9.32e-17 SMART
low complexity region 845 858 N/A INTRINSIC
SH3 880 937 3.7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165212
SMART Domains Protein: ENSMUSP00000126460
Gene: ENSMUSG00000025006

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
Sorb 193 239 1.07e-26 SMART
SH3 486 541 2.72e-18 SMART
SH3 560 617 9.32e-17 SMART
low complexity region 631 644 N/A INTRINSIC
SH3 666 723 3.7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165469
SMART Domains Protein: ENSMUSP00000125768
Gene: ENSMUSG00000025006

DomainStartEndE-ValueType
low complexity region 75 93 N/A INTRINSIC
Sorb 233 279 1.07e-26 SMART
SH3 476 531 2.72e-18 SMART
SH3 550 607 9.32e-17 SMART
low complexity region 621 634 N/A INTRINSIC
SH3 656 713 3.7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224233
Predicted Effect probably benign
Transcript: ENSMUST00000224247
Predicted Effect probably benign
Transcript: ENSMUST00000224583
Predicted Effect probably benign
Transcript: ENSMUST00000224667
Predicted Effect probably benign
Transcript: ENSMUST00000225148
Predicted Effect probably benign
Transcript: ENSMUST00000225153
AA Change: R180G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225786
Predicted Effect probably benign
Transcript: ENSMUST00000226047
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CBL-associated protein which functions in the signaling and stimulation of insulin. Mutations in this gene may be associated with human disorders of insulin resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased triglyceride levels, altered glucose homeostasis, decreased white blood cells and resistance to developing glucose intolerance induced by a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G T 7: 79,098,348 E956* probably null Het
Adam25 A T 8: 40,754,084 H129L probably benign Het
Adgrl4 A T 3: 151,439,322 H36L probably benign Het
Ago1 T A 4: 126,463,706 I59F possibly damaging Het
Anapc1 A T 2: 128,628,656 V1518E possibly damaging Het
Atxn1 A G 13: 45,566,835 I528T probably damaging Het
B4galnt4 A G 7: 141,070,680 H820R probably damaging Het
Cacna1h T C 17: 25,394,003 E282G probably damaging Het
Camk1 T A 6: 113,339,514 M95L probably benign Het
Capn7 C T 14: 31,336,685 probably benign Het
Cav1 A G 6: 17,339,144 E45G possibly damaging Het
Ccdc183 T G 2: 25,613,670 E185A probably benign Het
Ccl2 T A 11: 82,035,663 M1K probably null Het
Cep97 T A 16: 55,905,754 H590L probably benign Het
Dsg1c A T 18: 20,266,144 I102F probably damaging Het
Fam198a A T 9: 121,965,401 Q207L probably damaging Het
Fcho2 A G 13: 98,784,826 Y184H possibly damaging Het
Gart C T 16: 91,643,143 probably benign Het
Golga3 G A 5: 110,208,584 probably null Het
Hint3 G T 10: 30,610,384 A133E probably damaging Het
Hspe1 T C 1: 55,089,217 probably null Het
Insr A T 8: 3,258,418 V206E probably benign Het
Insrr T C 3: 87,815,244 S1258P probably damaging Het
Itga11 C T 9: 62,752,256 T430M probably damaging Het
Jmjd1c G A 10: 67,220,609 V890I possibly damaging Het
Kdm4b T A 17: 56,396,592 S717R probably damaging Het
Large1 A T 8: 73,116,464 C144S probably damaging Het
Lrat G T 3: 82,903,448 Q89K probably benign Het
Lrrc66 A T 5: 73,608,556 F381L possibly damaging Het
Myo15 A G 11: 60,506,006 T2634A probably damaging Het
Nup205 T G 6: 35,224,535 I1182M possibly damaging Het
Olfr1023 A T 2: 85,887,621 I274F probably benign Het
Olfr435 T A 6: 43,201,903 D86E probably benign Het
Olfr798 T A 10: 129,625,734 E109V probably damaging Het
Plekha6 T A 1: 133,272,460 V259D possibly damaging Het
Prdm9 C A 17: 15,544,995 A508S possibly damaging Het
Prickle2 A G 6: 92,376,305 F783L probably benign Het
Ptprc T C 1: 138,126,309 S31G probably benign Het
Rbak A T 5: 143,173,471 I609N probably damaging Het
Rimklb A T 6: 122,459,217 L134* probably null Het
Ripor2 A G 13: 24,693,766 I250V probably benign Het
Spaca6 C T 17: 17,836,096 L118F probably benign Het
Tmem167 G A 13: 90,098,414 C19Y probably benign Het
Togaram1 C T 12: 65,020,386 T1684I possibly damaging Het
Trappc8 T C 18: 20,874,672 T129A probably benign Het
Ubash3a A G 17: 31,228,210 S347G probably benign Het
Unc80 T C 1: 66,503,593 S289P probably benign Het
Vmn2r11 A G 5: 109,054,950 I87T probably damaging Het
Vmn2r54 A T 7: 12,629,824 F381I probably damaging Het
Wdsub1 A G 2: 59,852,880 L450P probably damaging Het
Xylt2 A G 11: 94,667,582 probably null Het
Zfp429 A T 13: 67,390,711 C205S probably damaging Het
Zfp60 T C 7: 27,749,026 I373T probably benign Het
Zfp738 A G 13: 67,670,301 S524P probably damaging Het
Other mutations in Sorbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Sorbs1 APN 19 40318029 missense probably damaging 1.00
IGL00776:Sorbs1 APN 19 40344351 splice site probably null
IGL00788:Sorbs1 APN 19 40337043 splice site probably benign
IGL00943:Sorbs1 APN 19 40295040 utr 3 prime probably benign
IGL01525:Sorbs1 APN 19 40349978 missense probably damaging 1.00
IGL01530:Sorbs1 APN 19 40376647 missense probably benign 0.01
IGL01951:Sorbs1 APN 19 40318016 splice site probably benign
IGL02159:Sorbs1 APN 19 40327596 missense probably damaging 0.96
IGL02252:Sorbs1 APN 19 40314397 missense probably damaging 1.00
IGL02613:Sorbs1 APN 19 40327547 missense probably damaging 1.00
IGL02643:Sorbs1 APN 19 40365133 missense possibly damaging 0.65
IGL02668:Sorbs1 APN 19 40314681 missense probably damaging 1.00
IGL02738:Sorbs1 APN 19 40376904 missense probably damaging 0.97
IGL02965:Sorbs1 APN 19 40376743 missense probably benign 0.01
IGL03083:Sorbs1 APN 19 40314376 missense probably damaging 1.00
IGL03173:Sorbs1 APN 19 40363262 missense probably damaging 1.00
IGL03286:Sorbs1 APN 19 40344414 missense probably damaging 0.99
IGL03292:Sorbs1 APN 19 40373565 missense possibly damaging 0.79
R0016:Sorbs1 UTSW 19 40314738 splice site probably benign
R0016:Sorbs1 UTSW 19 40314738 splice site probably benign
R0306:Sorbs1 UTSW 19 40344411 missense possibly damaging 0.94
R0526:Sorbs1 UTSW 19 40349948 missense probably damaging 1.00
R0551:Sorbs1 UTSW 19 40311816 missense probably damaging 1.00
R0688:Sorbs1 UTSW 19 40363262 missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40382606 missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40382606 missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40382606 missense probably damaging 1.00
R1891:Sorbs1 UTSW 19 40393460 missense probably damaging 0.99
R2066:Sorbs1 UTSW 19 40365028 unclassified probably null
R2148:Sorbs1 UTSW 19 40376824 missense possibly damaging 0.94
R2214:Sorbs1 UTSW 19 40296631 missense probably damaging 1.00
R2410:Sorbs1 UTSW 19 40373515 missense probably damaging 0.99
R2940:Sorbs1 UTSW 19 40373571 missense probably damaging 1.00
R3847:Sorbs1 UTSW 19 40314443 missense probably damaging 0.97
R4405:Sorbs1 UTSW 19 40395745 missense probably benign 0.03
R4544:Sorbs1 UTSW 19 40311850 missense probably damaging 0.99
R4618:Sorbs1 UTSW 19 40373518 missense probably damaging 0.99
R4731:Sorbs1 UTSW 19 40314689 missense probably benign 0.29
R4732:Sorbs1 UTSW 19 40314689 missense probably benign 0.29
R4733:Sorbs1 UTSW 19 40314689 missense probably benign 0.29
R4860:Sorbs1 UTSW 19 40337005 missense probably benign 0.44
R4860:Sorbs1 UTSW 19 40337005 missense probably benign 0.44
R4907:Sorbs1 UTSW 19 40340047 nonsense probably null
R4912:Sorbs1 UTSW 19 40311727 missense probably damaging 1.00
R5229:Sorbs1 UTSW 19 40340707 missense probably damaging 1.00
R5285:Sorbs1 UTSW 19 40321890 missense probably damaging 1.00
R5416:Sorbs1 UTSW 19 40376989 missense probably benign 0.06
R5706:Sorbs1 UTSW 19 40376881 missense probably benign
R5871:Sorbs1 UTSW 19 40398583 missense probably damaging 1.00
R5936:Sorbs1 UTSW 19 40324772 missense probably damaging 0.96
R6073:Sorbs1 UTSW 19 40314657 missense probably damaging 1.00
R6324:Sorbs1 UTSW 19 40321819 missense probably damaging 0.99
R6343:Sorbs1 UTSW 19 40376982 critical splice donor site probably null
R6561:Sorbs1 UTSW 19 40326052 missense probably benign
R6646:Sorbs1 UTSW 19 40325549 missense probably damaging 1.00
R6768:Sorbs1 UTSW 19 40327547 missense probably damaging 1.00
R6849:Sorbs1 UTSW 19 40376800 missense probably benign
R6850:Sorbs1 UTSW 19 40376800 missense probably benign
R6878:Sorbs1 UTSW 19 40376800 missense probably benign
R6879:Sorbs1 UTSW 19 40376800 missense probably benign
R6880:Sorbs1 UTSW 19 40376800 missense probably benign
R6908:Sorbs1 UTSW 19 40352332 missense probably damaging 1.00
R6980:Sorbs1 UTSW 19 40327616 nonsense probably null
R7040:Sorbs1 UTSW 19 40376800 missense probably benign
R7110:Sorbs1 UTSW 19 40376800 missense probably benign
R7122:Sorbs1 UTSW 19 40376800 missense probably benign
R7170:Sorbs1 UTSW 19 40326129 nonsense probably null
R7180:Sorbs1 UTSW 19 40376800 missense probably benign
R7185:Sorbs1 UTSW 19 40376800 missense probably benign
R7187:Sorbs1 UTSW 19 40376800 missense probably benign
R7254:Sorbs1 UTSW 19 40376800 missense probably benign
R7255:Sorbs1 UTSW 19 40376800 missense probably benign
R7401:Sorbs1 UTSW 19 40376800 missense probably benign
R7595:Sorbs1 UTSW 19 40314653 missense probably damaging 0.99
R7819:Sorbs1 UTSW 19 40376800 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCCAGCAAGCTTACGGTAC -3'
(R):5'- TTATTTCCCACAGGGTGCC -3'

Sequencing Primer
(F):5'- AGCTTACGGTACTTGAGACAGCTC -3'
(R):5'- CAGCCCCGTCTGAGGTAATAGTTG -3'
Posted On2019-05-13