Incidental Mutation 'R7042:Hcrtr1'
ID 547102
Institutional Source Beutler Lab
Gene Symbol Hcrtr1
Ensembl Gene ENSMUSG00000028778
Gene Name hypocretin (orexin) receptor 1
Synonyms OX1R
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R7042 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 130130217-130139359 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) A to G at 130130860 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030562] [ENSMUST00000030563] [ENSMUST00000118199] [ENSMUST00000119423] [ENSMUST00000120154] [ENSMUST00000164887]
AlphaFold P58307
Predicted Effect unknown
Transcript: ENSMUST00000030562
AA Change: V411A
SMART Domains Protein: ENSMUSP00000030562
Gene: ENSMUSG00000028778
AA Change: V411A

DomainStartEndE-ValueType
Pfam:7tm_1 63 358 8.8e-59 PFAM
low complexity region 406 415 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000030563
SMART Domains Protein: ENSMUSP00000030563
Gene: ENSMUSG00000028779

DomainStartEndE-ValueType
low complexity region 11 101 N/A INTRINSIC
EFh 109 137 2.5e-2 SMART
EFh 146 174 1.23e1 SMART
EFh 176 204 4.42e-3 SMART
Blast:EFh 243 273 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000118199
SMART Domains Protein: ENSMUSP00000112638
Gene: ENSMUSG00000028779

DomainStartEndE-ValueType
low complexity region 11 101 N/A INTRINSIC
EFh 109 137 2.5e-2 SMART
EFh 146 174 1.23e1 SMART
EFh 176 204 4.42e-3 SMART
Blast:EFh 243 273 3e-9 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000119423
AA Change: V411A
SMART Domains Protein: ENSMUSP00000112630
Gene: ENSMUSG00000028778
AA Change: V411A

DomainStartEndE-ValueType
Pfam:7tm_1 63 358 5.3e-56 PFAM
low complexity region 406 415 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000120154
AA Change: V411A
SMART Domains Protein: ENSMUSP00000113198
Gene: ENSMUSG00000028778
AA Change: V411A

DomainStartEndE-ValueType
Pfam:7tm_1 63 358 8.8e-59 PFAM
low complexity region 406 415 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000164887
AA Change: V411A
SMART Domains Protein: ENSMUSP00000127290
Gene: ENSMUSG00000028778
AA Change: V411A

DomainStartEndE-ValueType
Pfam:7tm_1 63 358 8.8e-59 PFAM
low complexity region 406 415 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor involved in the regulation of feeding behavior. The encoded protein selectively binds the hypothalamic neuropeptide orexin A. A related gene (HCRTR2) encodes a G-protein coupled receptor that binds orexin A and orexin B. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for one null allele display increased susceptibility to pharmacologically induced seizures. Mice homozygous for a second null allele display a decrease in depression like behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,885,098 S554G possibly damaging Het
Adcy7 G T 8: 88,315,750 R415L probably damaging Het
Aox1 A T 1: 58,102,600 I1182F probably damaging Het
Ccdc7b T A 8: 129,085,249 Y147N probably benign Het
Clcnka A G 4: 141,391,380 I398T probably damaging Het
Cst8 T A 2: 148,799,876 probably null Het
Dcxr T C 11: 120,727,015 D45G possibly damaging Het
Dhx38 A T 8: 109,556,985 M510K possibly damaging Het
Ebf1 T A 11: 44,991,511 H431Q probably damaging Het
Eml4 T C 17: 83,461,570 I681T probably damaging Het
Etf1 T C 18: 34,910,166 N164S probably benign Het
Fmo2 A G 1: 162,880,657 V303A probably damaging Het
Foxl2 T A 9: 98,955,662 M1K probably null Het
Gm3404 A T 5: 146,526,159 E50D probably benign Het
Gpr61 G A 3: 108,151,331 P5S possibly damaging Het
Ier3ip1 T A 18: 76,930,132 F3I possibly damaging Het
Ifi206 G A 1: 173,481,242 P396L Het
Ifi209 G A 1: 173,642,670 V275I probably benign Het
Ighv1-69 T C 12: 115,623,289 S75G probably benign Het
Kcnj3 A T 2: 55,594,865 H325L possibly damaging Het
Klrk1 A T 6: 129,616,771 S50T possibly damaging Het
Mfsd4b4 T A 10: 39,892,518 Y193F probably damaging Het
Nlrp5 A G 7: 23,417,480 I210V possibly damaging Het
Olfr1135 A T 2: 87,671,591 Y259N possibly damaging Het
Olfr1181 T A 2: 88,423,402 I208F possibly damaging Het
Olfr147 G T 9: 38,402,900 G6C probably damaging Het
Olfr930 A G 9: 38,930,326 S52G possibly damaging Het
Pax6 A T 2: 105,696,373 H208L probably benign Het
Pgc C A 17: 47,733,820 Q331K probably benign Het
Phldb1 A G 9: 44,694,424 S370P probably damaging Het
Pi4k2a T C 19: 42,104,898 I226T probably benign Het
Pick1 T C 15: 79,248,765 S342P probably damaging Het
Plscr1 A G 9: 92,271,535 M312V probably damaging Het
Ppp3cc T G 14: 70,225,019 K399Q probably benign Het
Qpctl T C 7: 19,147,018 H163R probably benign Het
Rab11fip5 A G 6: 85,374,128 V134A possibly damaging Het
Rasal1 T A 5: 120,663,960 probably null Het
Rem2 T A 14: 54,478,091 I171N probably damaging Het
Sec22a T A 16: 35,329,515 I214L probably benign Het
Setbp1 T C 18: 79,086,855 D54G probably damaging Het
Slc27a2 C T 2: 126,567,780 A294V probably damaging Het
Slfn14 T A 11: 83,276,604 D695V probably damaging Het
Smc6 T A 12: 11,309,300 I975K probably damaging Het
Spice1 T C 16: 44,385,680 F835L probably benign Het
Tars2 A T 3: 95,750,745 H222Q probably benign Het
Tmtc2 A T 10: 105,370,616 F273I probably damaging Het
Ttc39d C A 17: 80,216,462 D183E probably benign Het
Vasp A G 7: 19,262,021 S128P probably benign Het
Vcpip1 A G 1: 9,748,153 S2P unknown Het
Vmn2r98 T C 17: 19,080,922 Y729H probably benign Het
Wdr18 A T 10: 79,966,110 D243V probably benign Het
Wdr60 T C 12: 116,254,441 I182M probably benign Het
Xirp2 T C 2: 67,513,289 V1958A probably benign Het
Zfp451 A T 1: 33,777,393 M492K probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Other mutations in Hcrtr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Hcrtr1 APN 4 130137269 missense probably damaging 1.00
IGL00754:Hcrtr1 APN 4 130137233 missense probably damaging 1.00
IGL02005:Hcrtr1 APN 4 130137263 missense probably benign 0.31
R0084:Hcrtr1 UTSW 4 130137266 missense possibly damaging 0.79
R0590:Hcrtr1 UTSW 4 130135694 missense probably damaging 0.96
R1531:Hcrtr1 UTSW 4 130130927 nonsense probably null
R1659:Hcrtr1 UTSW 4 130135336 nonsense probably null
R2055:Hcrtr1 UTSW 4 130130887 missense probably benign 0.08
R3028:Hcrtr1 UTSW 4 130135811 missense probably benign 0.31
R4488:Hcrtr1 UTSW 4 130135763 missense probably benign 0.02
R4967:Hcrtr1 UTSW 4 130130999 missense possibly damaging 0.69
R5301:Hcrtr1 UTSW 4 130137670 splice site probably null
R5375:Hcrtr1 UTSW 4 130135725 missense probably benign 0.08
R5636:Hcrtr1 UTSW 4 130130945 missense possibly damaging 0.59
R6283:Hcrtr1 UTSW 4 130135340 missense probably benign 0.01
R6505:Hcrtr1 UTSW 4 130137586 missense probably benign
R7018:Hcrtr1 UTSW 4 130135868 missense probably damaging 1.00
R7091:Hcrtr1 UTSW 4 130130914 missense probably damaging 0.99
R7259:Hcrtr1 UTSW 4 130135818 missense possibly damaging 0.79
R7612:Hcrtr1 UTSW 4 130135685 missense possibly damaging 0.61
R8140:Hcrtr1 UTSW 4 130135290 missense probably damaging 0.99
R9410:Hcrtr1 UTSW 4 130135721 missense probably damaging 0.98
Z1177:Hcrtr1 UTSW 4 130133873 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGCAGCTTAAGCCCCTATC -3'
(R):5'- TGTTCCTTGAGGTCAACCCC -3'

Sequencing Primer
(F):5'- CCCTATCCACCCAGCTTAGG -3'
(R):5'- GAGGTCAACCCCCTTCCTG -3'
Posted On 2019-05-13