Incidental Mutation 'R7042:Rab11fip5'
ID547106
Institutional Source Beutler Lab
Gene Symbol Rab11fip5
Ensembl Gene ENSMUSG00000051343
Gene NameRAB11 family interacting protein 5 (class I)
SynonymsRIP11, D6Ertd32e, GAF1, 9130206P09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7042 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location85334962-85374634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85374128 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 134 (V134A)
Ref Sequence ENSEMBL: ENSMUSP00000058305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060837] [ENSMUST00000204087]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060837
AA Change: V134A

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058305
Gene: ENSMUSG00000051343
AA Change: V134A

DomainStartEndE-ValueType
C2 20 143 8.7e-7 SMART
low complexity region 248 265 N/A INTRINSIC
low complexity region 313 322 N/A INTRINSIC
low complexity region 356 391 N/A INTRINSIC
Pfam:RBD-FIP 593 640 5.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204087
AA Change: V134A

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000145402
Gene: ENSMUSG00000051343
AA Change: V134A

DomainStartEndE-ValueType
C2 20 143 5.8e-9 SMART
low complexity region 248 265 N/A INTRINSIC
low complexity region 313 322 N/A INTRINSIC
low complexity region 356 391 N/A INTRINSIC
low complexity region 529 547 N/A INTRINSIC
low complexity region 560 568 N/A INTRINSIC
low complexity region 603 627 N/A INTRINSIC
low complexity region 687 692 N/A INTRINSIC
low complexity region 713 732 N/A INTRINSIC
low complexity region 852 887 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 1037 1052 N/A INTRINSIC
low complexity region 1068 1106 N/A INTRINSIC
low complexity region 1115 1149 N/A INTRINSIC
Pfam:RBD-FIP 1266 1313 8.5e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a floxed allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,885,098 S554G possibly damaging Het
Adcy7 G T 8: 88,315,750 R415L probably damaging Het
Aox1 A T 1: 58,102,600 I1182F probably damaging Het
Ccdc7b T A 8: 129,085,249 Y147N probably benign Het
Clcnka A G 4: 141,391,380 I398T probably damaging Het
Cst8 T A 2: 148,799,876 probably null Het
Dcxr T C 11: 120,727,015 D45G possibly damaging Het
Dhx38 A T 8: 109,556,985 M510K possibly damaging Het
Ebf1 T A 11: 44,991,511 H431Q probably damaging Het
Eml4 T C 17: 83,461,570 I681T probably damaging Het
Etf1 T C 18: 34,910,166 N164S probably benign Het
Fmo2 A G 1: 162,880,657 V303A probably damaging Het
Foxl2 T A 9: 98,955,662 M1K probably null Het
Gm3404 A T 5: 146,526,159 E50D probably benign Het
Gpr61 G A 3: 108,151,331 P5S possibly damaging Het
Hcrtr1 A G 4: 130,130,860 probably benign Het
Ier3ip1 T A 18: 76,930,132 F3I possibly damaging Het
Ifi206 G A 1: 173,481,242 P396L Het
Ifi209 G A 1: 173,642,670 V275I probably benign Het
Ighv1-69 T C 12: 115,623,289 S75G probably benign Het
Kcnj3 A T 2: 55,594,865 H325L possibly damaging Het
Klrk1 A T 6: 129,616,771 S50T possibly damaging Het
Mfsd4b4 T A 10: 39,892,518 Y193F probably damaging Het
Nlrp5 A G 7: 23,417,480 I210V possibly damaging Het
Olfr1135 A T 2: 87,671,591 Y259N possibly damaging Het
Olfr1181 T A 2: 88,423,402 I208F possibly damaging Het
Olfr147 G T 9: 38,402,900 G6C probably damaging Het
Olfr930 A G 9: 38,930,326 S52G possibly damaging Het
Pax6 A T 2: 105,696,373 H208L probably benign Het
Pgc C A 17: 47,733,820 Q331K probably benign Het
Phldb1 A G 9: 44,694,424 S370P probably damaging Het
Pi4k2a T C 19: 42,104,898 I226T probably benign Het
Pick1 T C 15: 79,248,765 S342P probably damaging Het
Plscr1 A G 9: 92,271,535 M312V probably damaging Het
Ppp3cc T G 14: 70,225,019 K399Q probably benign Het
Qpctl T C 7: 19,147,018 H163R probably benign Het
Rasal1 T A 5: 120,663,960 probably null Het
Rem2 T A 14: 54,478,091 I171N probably damaging Het
Sec22a T A 16: 35,329,515 I214L probably benign Het
Setbp1 T C 18: 79,086,855 D54G probably damaging Het
Slc27a2 C T 2: 126,567,780 A294V probably damaging Het
Slfn14 T A 11: 83,276,604 D695V probably damaging Het
Smc6 T A 12: 11,309,300 I975K probably damaging Het
Spice1 T C 16: 44,385,680 F835L probably benign Het
Tars2 A T 3: 95,750,745 H222Q probably benign Het
Tmtc2 A T 10: 105,370,616 F273I probably damaging Het
Ttc39d C A 17: 80,216,462 D183E probably benign Het
Vasp A G 7: 19,262,021 S128P probably benign Het
Vcpip1 A G 1: 9,748,153 S2P unknown Het
Vmn2r98 T C 17: 19,080,922 Y729H probably benign Het
Wdr18 A T 10: 79,966,110 D243V probably benign Het
Wdr60 T C 12: 116,254,441 I182M probably benign Het
Xirp2 T C 2: 67,513,289 V1958A probably benign Het
Zfp451 A T 1: 33,777,393 M492K probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Other mutations in Rab11fip5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Rab11fip5 APN 6 85337552 missense probably damaging 1.00
IGL02471:Rab11fip5 APN 6 85348225 missense probably damaging 0.99
IGL02725:Rab11fip5 APN 6 85374489 missense probably damaging 0.99
IGL02737:Rab11fip5 APN 6 85348558 missense probably damaging 1.00
PIT4812001:Rab11fip5 UTSW 6 85341558 missense probably benign 0.38
R0627:Rab11fip5 UTSW 6 85348051 missense probably benign 0.05
R1652:Rab11fip5 UTSW 6 85348297 missense probably damaging 0.97
R1961:Rab11fip5 UTSW 6 85348991 missense possibly damaging 0.87
R2106:Rab11fip5 UTSW 6 85374387 missense probably damaging 0.98
R2142:Rab11fip5 UTSW 6 85337228 critical splice acceptor site probably null
R4729:Rab11fip5 UTSW 6 85374267 missense probably damaging 0.99
R5001:Rab11fip5 UTSW 6 85347806 missense probably damaging 1.00
R5116:Rab11fip5 UTSW 6 85348807 missense probably damaging 1.00
R5506:Rab11fip5 UTSW 6 85374137 missense probably damaging 1.00
R5801:Rab11fip5 UTSW 6 85337600 missense probably damaging 0.99
R6338:Rab11fip5 UTSW 6 85341378 missense possibly damaging 0.94
R6696:Rab11fip5 UTSW 6 85341946 missense possibly damaging 0.65
R6763:Rab11fip5 UTSW 6 85342170 missense probably benign 0.02
R6880:Rab11fip5 UTSW 6 85348845 missense probably damaging 0.99
R6932:Rab11fip5 UTSW 6 85341558 missense probably benign 0.38
R7112:Rab11fip5 UTSW 6 85348194 missense probably damaging 1.00
R7197:Rab11fip5 UTSW 6 85342155 missense probably damaging 1.00
R7384:Rab11fip5 UTSW 6 85348330 missense possibly damaging 0.47
R7395:Rab11fip5 UTSW 6 85341868 missense probably benign
R7451:Rab11fip5 UTSW 6 85341556 missense probably benign 0.06
R7482:Rab11fip5 UTSW 6 85340778 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CCATGTACTGCCAACGCTTG -3'
(R):5'- AGTGTTCGTTCGAGCTACC -3'

Sequencing Primer
(F):5'- ACTCCATCAGGCCTTCCAGG -3'
(R):5'- TTCGAGCTACCGCCTGGAG -3'
Posted On2019-05-13