Incidental Mutation 'R7042:Setbp1'
ID547139
Institutional Source Beutler Lab
Gene Symbol Setbp1
Ensembl Gene ENSMUSG00000024548
Gene NameSET binding protein 1
SynonymsSeb
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.628) question?
Stock #R7042 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location78750380-79109391 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79086855 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 54 (D54G)
Ref Sequence ENSEMBL: ENSMUSP00000025430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025430]
Predicted Effect probably damaging
Transcript: ENSMUST00000025430
AA Change: D54G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025430
Gene: ENSMUSG00000024548
AA Change: D54G

DomainStartEndE-ValueType
low complexity region 155 165 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 278 286 N/A INTRINSIC
AT_hook 528 540 4.64e-1 SMART
low complexity region 565 571 N/A INTRINSIC
low complexity region 594 617 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
AT_hook 960 972 1.89e-1 SMART
low complexity region 1086 1103 N/A INTRINSIC
low complexity region 1316 1337 N/A INTRINSIC
AT_hook 1393 1405 7.27e-1 SMART
low complexity region 1462 1486 N/A INTRINSIC
low complexity region 1498 1514 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a several motifs including a ski homology region and a SET-binding region in addition to three nuclear localization signals. The encoded protein has been shown to bind the SET nuclear oncogene which is involved in DNA replication. Mutations in this gene are associated with Schinzel-Giedion midface retraction syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,885,098 S554G possibly damaging Het
Adcy7 G T 8: 88,315,750 R415L probably damaging Het
Aox1 A T 1: 58,102,600 I1182F probably damaging Het
Ccdc7b T A 8: 129,085,249 Y147N probably benign Het
Clcnka A G 4: 141,391,380 I398T probably damaging Het
Cst8 T A 2: 148,799,876 probably null Het
Dcxr T C 11: 120,727,015 D45G possibly damaging Het
Dhx38 A T 8: 109,556,985 M510K possibly damaging Het
Ebf1 T A 11: 44,991,511 H431Q probably damaging Het
Eml4 T C 17: 83,461,570 I681T probably damaging Het
Etf1 T C 18: 34,910,166 N164S probably benign Het
Fmo2 A G 1: 162,880,657 V303A probably damaging Het
Foxl2 T A 9: 98,955,662 M1K probably null Het
Gm3404 A T 5: 146,526,159 E50D probably benign Het
Gpr61 G A 3: 108,151,331 P5S possibly damaging Het
Hcrtr1 A G 4: 130,130,860 probably benign Het
Ier3ip1 T A 18: 76,930,132 F3I possibly damaging Het
Ifi206 G A 1: 173,481,242 P396L Het
Ifi209 G A 1: 173,642,670 V275I probably benign Het
Ighv1-69 T C 12: 115,623,289 S75G probably benign Het
Kcnj3 A T 2: 55,594,865 H325L possibly damaging Het
Klrk1 A T 6: 129,616,771 S50T possibly damaging Het
Mfsd4b4 T A 10: 39,892,518 Y193F probably damaging Het
Nlrp5 A G 7: 23,417,480 I210V possibly damaging Het
Olfr1135 A T 2: 87,671,591 Y259N possibly damaging Het
Olfr1181 T A 2: 88,423,402 I208F possibly damaging Het
Olfr147 G T 9: 38,402,900 G6C probably damaging Het
Olfr930 A G 9: 38,930,326 S52G possibly damaging Het
Pax6 A T 2: 105,696,373 H208L probably benign Het
Pgc C A 17: 47,733,820 Q331K probably benign Het
Phldb1 A G 9: 44,694,424 S370P probably damaging Het
Pi4k2a T C 19: 42,104,898 I226T probably benign Het
Pick1 T C 15: 79,248,765 S342P probably damaging Het
Plscr1 A G 9: 92,271,535 M312V probably damaging Het
Ppp3cc T G 14: 70,225,019 K399Q probably benign Het
Qpctl T C 7: 19,147,018 H163R probably benign Het
Rab11fip5 A G 6: 85,374,128 V134A possibly damaging Het
Rasal1 T A 5: 120,663,960 probably null Het
Rem2 T A 14: 54,478,091 I171N probably damaging Het
Sec22a T A 16: 35,329,515 I214L probably benign Het
Slc27a2 C T 2: 126,567,780 A294V probably damaging Het
Slfn14 T A 11: 83,276,604 D695V probably damaging Het
Smc6 T A 12: 11,309,300 I975K probably damaging Het
Spice1 T C 16: 44,385,680 F835L probably benign Het
Tars2 A T 3: 95,750,745 H222Q probably benign Het
Tmtc2 A T 10: 105,370,616 F273I probably damaging Het
Ttc39d C A 17: 80,216,462 D183E probably benign Het
Vasp A G 7: 19,262,021 S128P probably benign Het
Vcpip1 A G 1: 9,748,153 S2P unknown Het
Vmn2r98 T C 17: 19,080,922 Y729H probably benign Het
Wdr18 A T 10: 79,966,110 D243V probably benign Het
Wdr60 T C 12: 116,254,441 I182M probably benign Het
Xirp2 T C 2: 67,513,289 V1958A probably benign Het
Zfp451 A T 1: 33,777,393 M492K probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Other mutations in Setbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Setbp1 APN 18 78755679 nonsense probably null 0.00
IGL00668:Setbp1 APN 18 78857770 missense probably damaging 1.00
IGL01628:Setbp1 APN 18 78856777 missense probably damaging 1.00
IGL02084:Setbp1 APN 18 78857410 missense probably damaging 1.00
IGL02405:Setbp1 APN 18 78857299 missense probably damaging 1.00
IGL02427:Setbp1 APN 18 78857473 missense probably damaging 1.00
IGL02612:Setbp1 APN 18 78755710 missense probably damaging 1.00
IGL02725:Setbp1 APN 18 78857374 nonsense probably null
IGL03005:Setbp1 APN 18 78859125 missense possibly damaging 0.75
IGL03123:Setbp1 APN 18 78857009 missense probably damaging 1.00
R1083:Setbp1 UTSW 18 78857626 missense probably damaging 1.00
R1110:Setbp1 UTSW 18 78857860 missense probably damaging 1.00
R1167:Setbp1 UTSW 18 78857236 missense possibly damaging 0.85
R1221:Setbp1 UTSW 18 78856583 missense probably damaging 1.00
R1225:Setbp1 UTSW 18 78858208 missense probably damaging 0.99
R1327:Setbp1 UTSW 18 78783358 missense probably benign 0.00
R1481:Setbp1 UTSW 18 78783301 missense probably benign 0.01
R1482:Setbp1 UTSW 18 79086835 missense probably damaging 1.00
R1496:Setbp1 UTSW 18 78859912 missense probably damaging 1.00
R1550:Setbp1 UTSW 18 78858592 missense probably damaging 1.00
R1708:Setbp1 UTSW 18 78858467 missense probably damaging 0.99
R1751:Setbp1 UTSW 18 78857398 missense probably damaging 1.00
R1922:Setbp1 UTSW 18 78858362 missense possibly damaging 0.75
R1986:Setbp1 UTSW 18 78858544 missense probably damaging 0.99
R2090:Setbp1 UTSW 18 78856720 missense probably benign 0.00
R2851:Setbp1 UTSW 18 78923996 missense probably benign 0.11
R2853:Setbp1 UTSW 18 78923996 missense probably benign 0.11
R2941:Setbp1 UTSW 18 78858197 missense probably damaging 1.00
R3151:Setbp1 UTSW 18 78857435 missense probably damaging 1.00
R3156:Setbp1 UTSW 18 78859303 missense probably benign 0.00
R3807:Setbp1 UTSW 18 78783322 missense probably benign 0.01
R4133:Setbp1 UTSW 18 78856991 missense probably benign 0.05
R4287:Setbp1 UTSW 18 78859061 missense probably benign 0.03
R4345:Setbp1 UTSW 18 79086579 missense probably damaging 0.99
R4374:Setbp1 UTSW 18 78859922 missense probably damaging 0.97
R4377:Setbp1 UTSW 18 78859922 missense probably damaging 0.97
R4378:Setbp1 UTSW 18 78856618 missense possibly damaging 0.95
R4379:Setbp1 UTSW 18 79086681 missense probably damaging 1.00
R4585:Setbp1 UTSW 18 79086949 missense probably benign 0.00
R4595:Setbp1 UTSW 18 78857516 missense probably benign 0.00
R4817:Setbp1 UTSW 18 78858800 missense probably damaging 1.00
R4971:Setbp1 UTSW 18 78858167 missense probably benign 0.07
R4976:Setbp1 UTSW 18 79086712 missense probably damaging 1.00
R5017:Setbp1 UTSW 18 78856594 missense possibly damaging 0.81
R5066:Setbp1 UTSW 18 78857299 missense probably damaging 1.00
R5133:Setbp1 UTSW 18 78857482 missense probably damaging 1.00
R5151:Setbp1 UTSW 18 78857999 missense probably damaging 1.00
R5237:Setbp1 UTSW 18 78856975 missense possibly damaging 0.92
R5480:Setbp1 UTSW 18 78858063 missense probably damaging 0.99
R5507:Setbp1 UTSW 18 79086712 missense probably damaging 1.00
R5529:Setbp1 UTSW 18 79086652 missense probably damaging 0.99
R5622:Setbp1 UTSW 18 78857485 missense probably damaging 1.00
R5722:Setbp1 UTSW 18 78856645 missense possibly damaging 0.95
R5806:Setbp1 UTSW 18 78856482 unclassified probably null
R5940:Setbp1 UTSW 18 78755488 missense probably damaging 1.00
R6025:Setbp1 UTSW 18 78859240 missense probably damaging 0.98
R6030:Setbp1 UTSW 18 78857711 missense probably benign 0.02
R6030:Setbp1 UTSW 18 78857711 missense probably benign 0.02
R6250:Setbp1 UTSW 18 78858002 missense probably benign 0.00
R6256:Setbp1 UTSW 18 78857257 missense probably damaging 1.00
R6332:Setbp1 UTSW 18 78783369 missense probably benign 0.21
R6522:Setbp1 UTSW 18 78857390 missense probably damaging 0.98
R6873:Setbp1 UTSW 18 78859559 missense probably benign 0.00
R6886:Setbp1 UTSW 18 78857500 missense probably damaging 1.00
R6986:Setbp1 UTSW 18 78857839 missense probably damaging 1.00
R7131:Setbp1 UTSW 18 79086960 missense probably benign 0.08
R7134:Setbp1 UTSW 18 78859519 missense possibly damaging 0.86
R7215:Setbp1 UTSW 18 78856837 missense probably damaging 0.97
R7219:Setbp1 UTSW 18 78755745 missense probably damaging 1.00
R7378:Setbp1 UTSW 18 78857486 missense probably damaging 1.00
R7461:Setbp1 UTSW 18 78856492 missense probably benign 0.06
R7589:Setbp1 UTSW 18 78856492 missense probably benign 0.01
R7840:Setbp1 UTSW 18 78783424 missense probably benign 0.03
R7849:Setbp1 UTSW 18 78856853 missense probably benign 0.00
R8147:Setbp1 UTSW 18 78856800 missense probably damaging 1.00
Z1088:Setbp1 UTSW 18 78859594 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCCCAGACTGCTTTATGGTG -3'
(R):5'- TAGGATTATCATGGAGCCCAGGG -3'

Sequencing Primer
(F):5'- CTCAGGTGGGCAGATATAGTTCTCC -3'
(R):5'- GAAATGTTAAGCAGCTGCCG -3'
Posted On2019-05-13