Mutagenetix > Incidental Mutation

Incidental Mutation 'R7043:Kcnb2'

547141

Institutional Source

Beutler Lab

Gene Symbol

Kcnb2

Ensembl Gene

ENSMUSG00000092083

Gene Name

potassium voltage gated channel, Shab-related subfamily, member 2

Synonyms

9630047L19Rik, Kv2.2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7043 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

15287254-15723750 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 15312926 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 159 (M159L)

Ref Sequence

ENSEMBL: ENSMUSP00000135382 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170146] [ENSMUST00000175681]

AlphaFold

A6H8H5

Predicted Effect

probably benign
Transcript: ENSMUST00000170146
AA Change: M159L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000175681
AA Change: M159L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000135382
Gene: ENSMUSG00000092083
AA Change: M159L

Domain	Start	End	E-Value	Type
BTB	35	144	2.59e-14	SMART
low complexity region	150	166	N/A	INTRINSIC
Pfam:Ion_trans	192	428	1.7e-51	PFAM
Pfam:Ion_trans_2	336	422	2.5e-13	PFAM
Pfam:Kv2channel	471	755	7.7e-149	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel. The gene is expressed in gastrointestinal smooth muscle cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit neurological abnormalities when compared with controls, including an abnormal sleep/wake cycle, decreased exploratory and locomotor activity, and a motor strength deficit. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	T	C	17: 33,065,332	D832G	possibly damaging	Het
Abca17	A	G	17: 24,265,500	L1596P	probably damaging	Het
Actr3b	A	G	5: 25,849,938	M329V	probably benign	Het
Avpr1a	C	T	10: 122,449,681	R293C	probably damaging	Het
Bdp1	A	T	13: 100,078,707	C390S	probably benign	Het
C2cd2l	A	T	9: 44,316,551	M131K	probably damaging	Het
Ccna2	T	C	3: 36,570,153		probably benign	Het
Cd53	T	C	3: 106,763,261	D152G	probably damaging	Het
Cdpf1	A	T	15: 85,808,284	V66E	probably null	Het
Chd9	G	T	8: 91,034,215		probably benign	Het
Crybg2	A	G	4: 134,091,136	D1710G	probably benign	Het
Dst	A	G	1: 34,257,911	T5794A	probably damaging	Het
Eif2s1	G	T	12: 78,877,108	R113L	probably damaging	Het
Eif5	A	G	12: 111,544,596	D423G	probably benign	Het
Eri1	A	C	8: 35,478,638	D164E	probably damaging	Het
F7	A	T	8: 13,033,997	R227S	probably benign	Het
Gm14496	T	G	2: 182,000,327	I597S	possibly damaging	Het
Gpr85	T	A	6: 13,835,877	N343Y	probably damaging	Het
H2-T23	A	T	17: 36,031,911	S112T	probably damaging	Het
Itga9	C	T	9: 118,769,116	P573S	probably damaging	Het
Kmt5b	T	A	19: 3,815,220	S738R	possibly damaging	Het
Lrp1b	T	C	2: 40,922,414	N2393S	possibly damaging	Het
Mme	T	A	3: 63,345,217	Y427*	probably null	Het
Naip1	A	G	13: 100,426,914	V581A	probably damaging	Het
Ndel1	A	G	11: 68,822,624	L329P	possibly damaging	Het
Nthl1	T	G	17: 24,638,670	V281G	probably benign	Het
Olfr597	C	A	7: 103,321,085		probably benign	Het
Per2	G	T	1: 91,419,408	H1197Q	probably benign	Het
Plec	G	A	15: 76,209,128		probably benign	Het
Prpf6	A	T	2: 181,649,504	H704L	probably benign	Het
Recql5	C	T	11: 115,930,676		probably null	Het
Rimbp3	G	A	16: 17,211,108	V799M	probably damaging	Het
Sema3f	C	T	9: 107,691,400	A169T	possibly damaging	Het
Serpinb9f	T	C	13: 33,325,987	I54T	possibly damaging	Het
Skint5	A	T	4: 113,717,107	L749Q	unknown	Het
Slc35g3	T	C	11: 69,761,650	D12G	probably benign	Het
Sptbn1	A	G	11: 30,103,323	V2252A	probably benign	Het
Stab2	T	C	10: 86,870,246	N1750S	probably damaging	Het
Supt5	C	A	7: 28,320,010	R543L	probably benign	Het
Syne1	T	C	10: 5,072,193	E7806G	possibly damaging	Het
Syt12	T	A	19: 4,451,021	M334L	probably benign	Het
Tk1	A	G	11: 117,815,953	*234R	probably null	Het
Trp73	T	G	4: 154,067,007		probably null	Het
Ttn	A	G	2: 76,897,133		probably benign	Het
Vmn2r11	T	C	5: 109,052,232	I452V	probably benign	Het
Wwox	G	T	8: 114,679,838	V190L	probably damaging	Het
Wwp2	A	G	8: 107,457,900	H80R	probably benign	Het
Zc3h3	A	G	15: 75,809,636	I532T	probably damaging	Het
Zfp280d	A	G	9: 72,319,257	K328E	probably damaging	Het
Zfp365	A	G	10: 67,909,826	S41P	probably damaging	Het

Other mutations in Kcnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Kcnb2	APN	1	15711012	missense	probably benign	0.02
IGL01321:Kcnb2	APN	1	15312923	missense	probably benign	0.09
IGL01353:Kcnb2	APN	1	15710824	missense	probably benign	0.02
IGL01990:Kcnb2	APN	1	15312954	missense	probably benign	0.19
IGL02008:Kcnb2	APN	1	15710809	missense	probably benign	0.00
IGL02120:Kcnb2	APN	1	15709861	missense	probably damaging	0.98
IGL02370:Kcnb2	APN	1	15710935	missense	probably benign
IGL02526:Kcnb2	APN	1	15710755	missense	probably damaging	1.00
IGL02859:Kcnb2	APN	1	15710506	missense	probably damaging	1.00
IGL03039:Kcnb2	APN	1	15711211	missense	probably benign
IGL03144:Kcnb2	APN	1	15709888	missense	probably damaging	1.00
F5770:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
PIT4131001:Kcnb2	UTSW	1	15312976	missense	possibly damaging	0.92
R0266:Kcnb2	UTSW	1	15712913	unclassified	probably benign
R0538:Kcnb2	UTSW	1	15712884	unclassified	probably benign
R0611:Kcnb2	UTSW	1	15710440	missense	probably benign	0.07
R1542:Kcnb2	UTSW	1	15710788	missense	probably benign	0.01
R1732:Kcnb2	UTSW	1	15709755	missense	probably benign	0.02
R1995:Kcnb2	UTSW	1	15709766	missense	possibly damaging	0.66
R2166:Kcnb2	UTSW	1	15711316	missense	possibly damaging	0.82
R2444:Kcnb2	UTSW	1	15709567	missense	probably benign
R3025:Kcnb2	UTSW	1	15710835	missense	possibly damaging	0.87
R3886:Kcnb2	UTSW	1	15710415	missense	probably damaging	1.00
R5010:Kcnb2	UTSW	1	15312962	missense	probably benign	0.09
R5039:Kcnb2	UTSW	1	15709500	missense	probably damaging	1.00
R5096:Kcnb2	UTSW	1	15710844	missense	probably benign	0.45
R5444:Kcnb2	UTSW	1	15711492	missense	probably benign
R5926:Kcnb2	UTSW	1	15313011	missense	probably benign	0.01
R6010:Kcnb2	UTSW	1	15710566	missense	possibly damaging	0.85
R6371:Kcnb2	UTSW	1	15711212	missense	probably benign
R6724:Kcnb2	UTSW	1	15710440	missense	probably damaging	1.00
R6981:Kcnb2	UTSW	1	15710256	missense	probably damaging	1.00
R7352:Kcnb2	UTSW	1	15710611	missense	probably benign
R7419:Kcnb2	UTSW	1	15711027	missense	possibly damaging	0.94
R7425:Kcnb2	UTSW	1	15709807	missense	probably damaging	1.00
R7606:Kcnb2	UTSW	1	15312840	missense	probably damaging	1.00
R7978:Kcnb2	UTSW	1	15710613	missense	probably benign	0.15
R7983:Kcnb2	UTSW	1	15312780	missense	probably damaging	0.98
R8115:Kcnb2	UTSW	1	15711627	makesense	probably null
R8156:Kcnb2	UTSW	1	15710056	missense	probably damaging	1.00
R8408:Kcnb2	UTSW	1	15711553	missense	probably damaging	1.00
R8439:Kcnb2	UTSW	1	15312710	missense	probably damaging	1.00
R8726:Kcnb2	UTSW	1	15710652	missense	probably benign	0.00
R8738:Kcnb2	UTSW	1	15710424	missense	probably benign	0.07
R9274:Kcnb2	UTSW	1	15711499	missense	probably benign
R9321:Kcnb2	UTSW	1	15709569	missense	possibly damaging	0.46
R9563:Kcnb2	UTSW	1	15709513	missense	probably damaging	1.00
R9633:Kcnb2	UTSW	1	15711220	missense	probably benign
R9709:Kcnb2	UTSW	1	15710299	missense	probably benign	0.31
V7580:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
V7581:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
V7582:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
V7583:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
Z1088:Kcnb2	UTSW	1	15710091	missense	probably benign	0.03
Z1088:Kcnb2	UTSW	1	15711028	missense	probably benign	0.01
Z1177:Kcnb2	UTSW	1	15710958	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- TTCTAAACTTCTACCGGACGGG -3'
(R):5'- TACATTACCTGTGAGGCCATG -3'

Sequencing Primer
(F):5'- CGGGGAAGCTCCACATGATG -3'
(R):5'- GTTCTGTTTTACCAAAGCAGTGAAG -3'

Posted On

2019-05-13