Mutagenetix > Incidental Mutations

Incidental Mutation 'R7043:Tk1'

547174

Institutional Source

Beutler Lab

Gene Symbol

Tk1

Ensembl Gene

ENSMUSG00000025574

Gene Name

thymidine kinase 1

Synonyms

D530002A18Rik, Tk-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7043 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

117815526-117826092 bp(-) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

A to G at 117815953 bp

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Arginine at position 234 (*234R)

Ref Sequence

ENSEMBL: ENSMUSP00000026661 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026649] [ENSMUST00000026661] [ENSMUST00000120928] [ENSMUST00000132298] [ENSMUST00000143852] [ENSMUST00000177131] [ENSMUST00000177241]

Predicted Effect

probably benign
Transcript: ENSMUST00000026649

SMART Domains

Protein: ENSMUSP00000026649
Gene: ENSMUSG00000048277

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
Pfam:MARVEL	20	165	1.1e-24	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000026661
AA Change: *234R

SMART Domains

Protein: ENSMUSP00000026661
Gene: ENSMUSG00000025574
AA Change: *234R

Domain	Start	End	E-Value	Type
Pfam:TK	19	189	9.8e-73	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120928

SMART Domains

Protein: ENSMUSP00000113941
Gene: ENSMUSG00000048277

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
Pfam:MARVEL	21	135	1.4e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000132298

SMART Domains

Protein: ENSMUSP00000135368
Gene: ENSMUSG00000093485

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	34	43	N/A	INTRINSIC
low complexity region	90	102	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000143852

SMART Domains

Protein: ENSMUSP00000135529
Gene: ENSMUSG00000048277

Domain	Start	End	E-Value	Type
Pfam:MARVEL	14	118	8e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000175737

SMART Domains

Protein: ENSMUSP00000134879
Gene: ENSMUSG00000048277

Domain	Start	End	E-Value	Type
low complexity region	1	11	N/A	INTRINSIC
Pfam:MARVEL	18	121	1.4e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177131

SMART Domains

Protein: ENSMUSP00000134789
Gene: ENSMUSG00000048277

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
Pfam:MARVEL	20	162	3.6e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177241

Meta Mutation Damage Score

0.8845

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytosolic enzyme that catalyzes the addition of a gamma-phosphate group to thymidine. This creates dTMP and is the first step in the biosynthesis of dTTP, which is one component required for DNA replication. The encoded protein, whose levels fluctuate depending on the cell cycle stage, can act as a low activity dimer or a high activity tetramer. High levels of this protein have been used as a biomarker for diagnosing and categorizing many types of cancers. [provided by RefSeq, Oct 2016]
PHENOTYPE: Nullizygous mice show partial postnatal lethality, poor fertility, hemosiderosis, lymphocyte and spleen anomalies, altered sublingual gland secretion, inflammation of the arteries, lung, liver and thyroid, abnormal spermatogenesis and glomerulosclerosis leading to kidney failure and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	T	C	17: 33,065,332	D832G	possibly damaging	Het
Abca17	A	G	17: 24,265,500	L1596P	probably damaging	Het
Actr3b	A	G	5: 25,849,938	M329V	probably benign	Het
Avpr1a	C	T	10: 122,449,681	R293C	probably damaging	Het
Bdp1	A	T	13: 100,078,707	C390S	probably benign	Het
C2cd2l	A	T	9: 44,316,551	M131K	probably damaging	Het
Ccna2	T	C	3: 36,570,153		probably benign	Het
Cd53	T	C	3: 106,763,261	D152G	probably damaging	Het
Cdpf1	A	T	15: 85,808,284	V66E	probably null	Het
Chd9	G	T	8: 91,034,215		probably benign	Het
Crybg2	A	G	4: 134,091,136	D1710G	probably benign	Het
Dst	A	G	1: 34,257,911	T5794A	probably damaging	Het
Eif2s1	G	T	12: 78,877,108	R113L	probably damaging	Het
Eif5	A	G	12: 111,544,596	D423G	probably benign	Het
Eri1	A	C	8: 35,478,638	D164E	probably damaging	Het
F7	A	T	8: 13,033,997	R227S	probably benign	Het
Gm14496	T	G	2: 182,000,327	I597S	possibly damaging	Het
Gpr85	T	A	6: 13,835,877	N343Y	probably damaging	Het
H2-T23	A	T	17: 36,031,911	S112T	probably damaging	Het
Itga9	C	T	9: 118,769,116	P573S	probably damaging	Het
Kcnb2	A	T	1: 15,312,926	M159L	probably benign	Het
Kmt5b	T	A	19: 3,815,220	S738R	possibly damaging	Het
Lrp1b	T	C	2: 40,922,414	N2393S	possibly damaging	Het
Mme	T	A	3: 63,345,217	Y427*	probably null	Het
Naip1	A	G	13: 100,426,914	V581A	probably damaging	Het
Ndel1	A	G	11: 68,822,624	L329P	possibly damaging	Het
Nthl1	T	G	17: 24,638,670	V281G	probably benign	Het
Olfr597	C	A	7: 103,321,085		probably benign	Het
Per2	G	T	1: 91,419,408	H1197Q	probably benign	Het
Plec	G	A	15: 76,209,128		probably benign	Het
Prpf6	A	T	2: 181,649,504	H704L	probably benign	Het
Recql5	C	T	11: 115,930,676		probably null	Het
Rimbp3	G	A	16: 17,211,108	V799M	probably damaging	Het
Sema3f	C	T	9: 107,691,400	A169T	possibly damaging	Het
Serpinb9f	T	C	13: 33,325,987	I54T	possibly damaging	Het
Skint5	A	T	4: 113,717,107	L749Q	unknown	Het
Slc35g3	T	C	11: 69,761,650	D12G	probably benign	Het
Sptbn1	A	G	11: 30,103,323	V2252A	probably benign	Het
Stab2	T	C	10: 86,870,246	N1750S	probably damaging	Het
Supt5	C	A	7: 28,320,010	R543L	probably benign	Het
Syne1	T	C	10: 5,072,193	E7806G	possibly damaging	Het
Syt12	T	A	19: 4,451,021	M334L	probably benign	Het
Trp73	T	G	4: 154,067,007		probably null	Het
Ttn	A	G	2: 76,897,133		probably benign	Het
Vmn2r11	T	C	5: 109,052,232	I452V	probably benign	Het
Wwox	G	T	8: 114,679,838	V190L	probably damaging	Het
Wwp2	A	G	8: 107,457,900	H80R	probably benign	Het
Zc3h3	A	G	15: 75,809,636	I532T	probably damaging	Het
Zfp280d	A	G	9: 72,319,257	K328E	probably damaging	Het
Zfp365	A	G	10: 67,909,826	S41P	probably damaging	Het

Other mutations in Tk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02082:Tk1	APN	11	117825727	unclassified	probably null
IGL02088:Tk1	APN	11	117824665	unclassified	probably benign
blowout	UTSW	11	117815953	makesense	probably null
sale	UTSW	11	117825777	start codon destroyed	probably null	0.01
tica	UTSW	11	117817122	unclassified	probably benign
tico	UTSW	11	117816541	missense	probably damaging	1.00
tock	UTSW	11	117816494	missense	probably damaging	1.00
R0310:Tk1	UTSW	11	117817095	unclassified	probably benign
R0811:Tk1	UTSW	11	117822107	missense	probably damaging	1.00
R0812:Tk1	UTSW	11	117822107	missense	probably damaging	1.00
R1180:Tk1	UTSW	11	117822095	critical splice donor site	probably null
R5160:Tk1	UTSW	11	117824746	missense	possibly damaging	0.78
R5287:Tk1	UTSW	11	117816541	missense	probably damaging	1.00
R5846:Tk1	UTSW	11	117815922	unclassified	probably benign
R5886:Tk1	UTSW	11	117817122	unclassified	probably benign
R6862:Tk1	UTSW	11	117816494	missense	probably damaging	1.00
R7292:Tk1	UTSW	11	117825777	start codon destroyed	probably null	0.01

Predicted Primers

PCR Primer
(F):5'- CACCAGTGTCACAATGCTGGAC -3'
(R):5'- CCGACAAGTATCACTCCGTG -3'

Sequencing Primer
(F):5'- TCACCTTTGGCTGAACACGG -3'
(R):5'- ACAAGTATCACTCCGTGTGCCG -3'

Posted On

2019-05-13