Incidental Mutation 'R7044:Ckap5'
ID547197
Institutional Source Beutler Lab
Gene Symbol Ckap5
Ensembl Gene ENSMUSG00000040549
Gene Namecytoskeleton associated protein 5
Synonyms4930432B04Rik, 3110043H24Rik, D730027C18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7044 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location91526762-91620664 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91577601 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 824 (I824T)
Ref Sequence ENSEMBL: ENSMUSP00000106970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046769] [ENSMUST00000099716] [ENSMUST00000111337] [ENSMUST00000111338]
Predicted Effect probably benign
Transcript: ENSMUST00000046769
AA Change: I824T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046263
Gene: ENSMUSG00000040549
AA Change: I824T

DomainStartEndE-ValueType
TOG 1 227 9.27e-53 SMART
low complexity region 234 261 N/A INTRINSIC
TOG 269 506 1.36e-77 SMART
low complexity region 537 551 N/A INTRINSIC
TOG 586 818 1.29e-69 SMART
low complexity region 833 845 N/A INTRINSIC
TOG 850 1082 3.27e-71 SMART
TOG 1191 1429 3.32e-63 SMART
low complexity region 1685 1698 N/A INTRINSIC
low complexity region 1759 1771 N/A INTRINSIC
low complexity region 1981 1994 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099716
AA Change: I824T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097303
Gene: ENSMUSG00000040549
AA Change: I824T

DomainStartEndE-ValueType
TOG 1 227 9.27e-53 SMART
low complexity region 234 261 N/A INTRINSIC
TOG 269 506 1.36e-77 SMART
low complexity region 537 551 N/A INTRINSIC
TOG 586 818 1.29e-69 SMART
low complexity region 833 845 N/A INTRINSIC
TOG 850 1082 3.27e-71 SMART
TOG 1191 1429 3.32e-63 SMART
low complexity region 1685 1698 N/A INTRINSIC
low complexity region 1759 1771 N/A INTRINSIC
low complexity region 1909 1921 N/A INTRINSIC
low complexity region 2002 2015 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111337
AA Change: I824T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106969
Gene: ENSMUSG00000040549
AA Change: I824T

DomainStartEndE-ValueType
TOG 1 227 9.27e-53 SMART
low complexity region 234 261 N/A INTRINSIC
TOG 269 506 1.36e-77 SMART
low complexity region 537 551 N/A INTRINSIC
TOG 586 818 1.29e-69 SMART
low complexity region 833 845 N/A INTRINSIC
TOG 850 1082 3.27e-71 SMART
TOG 1191 1429 3.32e-63 SMART
low complexity region 1625 1638 N/A INTRINSIC
low complexity region 1699 1711 N/A INTRINSIC
low complexity region 1849 1861 N/A INTRINSIC
low complexity region 1942 1955 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111338
AA Change: I824T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106970
Gene: ENSMUSG00000040549
AA Change: I824T

DomainStartEndE-ValueType
TOG 1 227 9.27e-53 SMART
low complexity region 234 261 N/A INTRINSIC
TOG 269 506 1.36e-77 SMART
low complexity region 537 551 N/A INTRINSIC
TOG 586 818 1.29e-69 SMART
low complexity region 833 845 N/A INTRINSIC
TOG 850 1082 3.27e-71 SMART
TOG 1191 1429 3.32e-63 SMART
low complexity region 1685 1698 N/A INTRINSIC
low complexity region 1759 1771 N/A INTRINSIC
low complexity region 1909 1921 N/A INTRINSIC
low complexity region 2002 2015 N/A INTRINSIC
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeleton-associated protein which belongs to the TOG/XMAP215 family. The N-terminal half of this protein contains a microtubule-binding domain and the C-terminal half contains a KXGS motif for binding tubulin dimers. This protein has two distinct roles in spindle formation; it protects kinetochore microtubules from depolymerization and plays an essential role in centrosomal microtubule assembly. This protein may be necessary for the proper interaction of microtubules with the cell cortex for directional cell movement. It also plays a role in translation of the myelin basic protein (MBP) mRNA by interacting with heterogeneous nuclear ribonucleoprotein (hnRNP) A2, which associates with MBP. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit decreased body size and cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,612,280 D1169N possibly damaging Het
Ankrd6 T A 4: 32,815,260 Q448L possibly damaging Het
Appl1 A G 14: 26,928,677 S513P possibly damaging Het
Cdhr2 A T 13: 54,733,321 K1066* probably null Het
Ctbp2 T C 7: 133,015,102 R35G possibly damaging Het
Dcdc2c T C 12: 28,470,494 probably benign Het
Eya1 T A 1: 14,231,410 probably null Het
Fam105a A G 15: 27,657,235 probably benign Het
Fam207a T C 10: 77,514,392 D35G possibly damaging Het
Fat4 G C 3: 39,010,810 A4972P probably benign Het
Fat4 C T 3: 39,010,811 A4972V probably benign Het
Fbxl8 T A 8: 105,267,015 M1K probably null Het
Glyat T C 19: 12,650,265 S75P probably benign Het
Gm3543 T A 14: 41,980,066 I154F probably damaging Het
Gm4565 T A 7: 22,583,370 M8L probably benign Het
Gpr179 T C 11: 97,349,790 Q269R probably benign Het
Hfe2 C A 3: 96,527,474 H176Q possibly damaging Het
Ikzf2 T C 1: 69,538,901 H483R possibly damaging Het
Il25 G A 14: 54,933,158 A63T probably benign Het
Krt27 T A 11: 99,346,814 N366I probably benign Het
Mfge8 A G 7: 79,142,520 V219A probably benign Het
Nrbp1 T C 5: 31,249,946 V373A probably damaging Het
Olfr1186 A G 2: 88,526,486 N301S probably benign Het
Pcdh20 A G 14: 88,469,171 I231T probably damaging Het
Pfkp A G 13: 6,581,567 W151R probably damaging Het
Pikfyve T C 1: 65,246,854 I1084T probably benign Het
Poteg T C 8: 27,449,895 C27R probably damaging Het
Ptprz1 G A 6: 23,044,346 V1266M probably damaging Het
Rpa1 T C 11: 75,312,802 D358G probably damaging Het
Snapc4 A G 2: 26,369,953 S495P probably damaging Het
Surf6 A G 2: 26,899,356 I123T probably damaging Het
Sybu A T 15: 44,677,695 S324T possibly damaging Het
Trim3 A T 7: 105,618,214 S319R probably damaging Het
Trmt11 A G 10: 30,590,934 F72L probably benign Het
Tsks C T 7: 44,943,792 R61W probably damaging Het
Ube2k T C 5: 65,581,429 V36A possibly damaging Het
Ube3a T C 7: 59,288,413 V688A probably damaging Het
Vegfc A G 8: 54,157,045 K79E possibly damaging Het
Vmn1r77 G A 7: 12,041,834 R179Q probably benign Het
Vmn2r97 T A 17: 18,914,367 F16I probably benign Het
Zfp451 A T 1: 33,802,167 probably benign Het
Zfp600 C T 4: 146,195,322 Q187* probably null Het
Other mutations in Ckap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Ckap5 APN 2 91606256 missense probably damaging 1.00
IGL00566:Ckap5 APN 2 91568627 splice site probably benign
IGL00585:Ckap5 APN 2 91619825 missense probably damaging 1.00
IGL00910:Ckap5 APN 2 91576050 missense probably benign 0.32
IGL01309:Ckap5 APN 2 91570184 missense probably damaging 0.99
IGL01411:Ckap5 APN 2 91601011 missense probably benign 0.26
IGL01654:Ckap5 APN 2 91577609 missense probably benign 0.26
IGL01684:Ckap5 APN 2 91555354 missense probably benign 0.06
IGL02031:Ckap5 APN 2 91612772 missense possibly damaging 0.85
IGL02057:Ckap5 APN 2 91600707 missense possibly damaging 0.91
IGL02101:Ckap5 APN 2 91572540 splice site probably benign
IGL02250:Ckap5 APN 2 91548901 missense probably damaging 1.00
IGL02556:Ckap5 APN 2 91594841 splice site probably benign
IGL02620:Ckap5 APN 2 91606369 missense probably benign 0.01
IGL02627:Ckap5 APN 2 91576021 missense probably damaging 1.00
IGL02693:Ckap5 APN 2 91570211 missense probably damaging 1.00
IGL02808:Ckap5 APN 2 91596514 missense probably damaging 1.00
IGL03086:Ckap5 APN 2 91570276 splice site probably benign
K7371:Ckap5 UTSW 2 91595523 splice site probably benign
R0106:Ckap5 UTSW 2 91578205 missense possibly damaging 0.90
R0106:Ckap5 UTSW 2 91615840 missense probably damaging 1.00
R0114:Ckap5 UTSW 2 91620112 missense possibly damaging 0.86
R0464:Ckap5 UTSW 2 91579513 missense probably benign 0.00
R0633:Ckap5 UTSW 2 91550743 missense probably damaging 0.96
R0723:Ckap5 UTSW 2 91555331 missense probably damaging 0.99
R1037:Ckap5 UTSW 2 91550629 missense probably benign 0.00
R1139:Ckap5 UTSW 2 91581143 missense probably benign 0.11
R1161:Ckap5 UTSW 2 91599375 missense probably null 1.00
R1183:Ckap5 UTSW 2 91586266 missense probably benign 0.01
R1660:Ckap5 UTSW 2 91562958 missense possibly damaging 0.92
R1850:Ckap5 UTSW 2 91595713 missense probably damaging 1.00
R1951:Ckap5 UTSW 2 91556492 splice site probably benign
R1968:Ckap5 UTSW 2 91586343 missense probably benign 0.10
R2004:Ckap5 UTSW 2 91607546 missense possibly damaging 0.91
R2143:Ckap5 UTSW 2 91565745 missense probably benign 0.00
R2391:Ckap5 UTSW 2 91585869 missense possibly damaging 0.66
R2435:Ckap5 UTSW 2 91581145 missense probably benign 0.01
R2438:Ckap5 UTSW 2 91595408 missense possibly damaging 0.95
R2680:Ckap5 UTSW 2 91588698 missense probably benign
R2698:Ckap5 UTSW 2 91578081 missense probably damaging 1.00
R3420:Ckap5 UTSW 2 91570252 missense probably damaging 0.99
R3422:Ckap5 UTSW 2 91570252 missense probably damaging 0.99
R3696:Ckap5 UTSW 2 91620166 missense probably benign 0.15
R3698:Ckap5 UTSW 2 91620166 missense probably benign 0.15
R3877:Ckap5 UTSW 2 91615150 missense possibly damaging 0.69
R4453:Ckap5 UTSW 2 91548845 missense probably damaging 1.00
R4604:Ckap5 UTSW 2 91578131 missense probably benign 0.00
R4605:Ckap5 UTSW 2 91576214 missense probably damaging 1.00
R4849:Ckap5 UTSW 2 91615271 missense probably damaging 1.00
R5267:Ckap5 UTSW 2 91591752 missense probably null 1.00
R5367:Ckap5 UTSW 2 91615141 missense possibly damaging 0.69
R5481:Ckap5 UTSW 2 91572447 missense possibly damaging 0.62
R5546:Ckap5 UTSW 2 91594816 missense probably damaging 1.00
R5704:Ckap5 UTSW 2 91576203 missense probably damaging 1.00
R5786:Ckap5 UTSW 2 91616296 splice site probably null
R5793:Ckap5 UTSW 2 91619835 missense possibly damaging 0.74
R5824:Ckap5 UTSW 2 91559136 missense probably benign 0.34
R5841:Ckap5 UTSW 2 91600682 missense probably benign 0.05
R5875:Ckap5 UTSW 2 91560861 missense probably benign
R5935:Ckap5 UTSW 2 91615100 missense possibly damaging 0.68
R6008:Ckap5 UTSW 2 91562989 missense probably damaging 0.99
R6174:Ckap5 UTSW 2 91568219 missense probably benign 0.00
R6343:Ckap5 UTSW 2 91596474 missense possibly damaging 0.95
R6624:Ckap5 UTSW 2 91577651 missense probably benign 0.01
R6786:Ckap5 UTSW 2 91557575 missense probably benign 0.01
R6793:Ckap5 UTSW 2 91568709 missense probably damaging 1.00
R6841:Ckap5 UTSW 2 91570252 missense probably damaging 0.99
R6972:Ckap5 UTSW 2 91606313 missense probably damaging 0.98
R7111:Ckap5 UTSW 2 91607572 missense probably damaging 1.00
R7790:Ckap5 UTSW 2 91559110 missense probably benign
R7809:Ckap5 UTSW 2 91606357 missense probably benign 0.28
R7921:Ckap5 UTSW 2 91548940 missense probably damaging 0.96
R8125:Ckap5 UTSW 2 91576269 missense probably damaging 1.00
R8331:Ckap5 UTSW 2 91576200 missense probably damaging 1.00
R8342:Ckap5 UTSW 2 91606362 missense possibly damaging 0.67
X0010:Ckap5 UTSW 2 91596509 missense possibly damaging 0.61
Z1177:Ckap5 UTSW 2 91585798 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAATTAGGATCTAGCTAGCAAC -3'
(R):5'- GGTACCCAAACTCCCTTTACTG -3'

Sequencing Primer
(F):5'- CACTTGGTAGCATGCATAAGATCCTG -3'
(R):5'- TGTCTACTTGGCAATCAGGAAGC -3'
Posted On2019-05-13