Incidental Mutation 'R7044:Hfe2'
ID547200
Institutional Source Beutler Lab
Gene Symbol Hfe2
Ensembl Gene ENSMUSG00000038403
Gene Namehemochromatosis type 2 (juvenile)
Synonyms5230400G09Rik, DL-M, Rgmc, hemojuvelin, HJV, 2310035L15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7044 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location96525172-96529210 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 96527474 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 176 (H176Q)
Ref Sequence ENSEMBL: ENSMUSP00000046659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049208]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049208
AA Change: H176Q

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000046659
Gene: ENSMUSG00000038403
AA Change: H176Q

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:RGM_N 34 219 6.2e-61 PFAM
Pfam:RGM_C 223 389 4.7e-59 PFAM
transmembrane domain 397 419 N/A INTRINSIC
Meta Mutation Damage Score 0.0787 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is involved in iron metabolism. It may be a component of the signaling pathway which activates hepcidin or it may act as a modulator of hepcidin expression. It could also represent the cellular receptor for hepcidin. Two uORFs in the 5' UTR negatively regulate the expression and activity of the encoded protein. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. Defects in this gene are the cause of hemochromatosis type 2A, also called juvenile hemochromatosis (JH). JH is an early-onset autosomal recessive disorder due to severe iron overload resulting in hypogonadotrophic hypogonadism, hepatic fibrosis or cirrhosis and cardiomyopathy, occurring typically before age of 30. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lack of hepcidin expression, severe iron overload and male sterility. Mice homozygous for a different knock-out allele display systemic iron overload, a severe deficit in hepcidin production, overexpression of ferroportin but normal male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,612,280 D1169N possibly damaging Het
Ankrd6 T A 4: 32,815,260 Q448L possibly damaging Het
Appl1 A G 14: 26,928,677 S513P possibly damaging Het
Cdhr2 A T 13: 54,733,321 K1066* probably null Het
Ckap5 T C 2: 91,577,601 I824T probably benign Het
Ctbp2 T C 7: 133,015,102 R35G possibly damaging Het
Dcdc2c T C 12: 28,470,494 probably benign Het
Eya1 T A 1: 14,231,410 probably null Het
Fam105a A G 15: 27,657,235 probably benign Het
Fam207a T C 10: 77,514,392 D35G possibly damaging Het
Fat4 G C 3: 39,010,810 A4972P probably benign Het
Fat4 C T 3: 39,010,811 A4972V probably benign Het
Fbxl8 T A 8: 105,267,015 M1K probably null Het
Glyat T C 19: 12,650,265 S75P probably benign Het
Gm3543 T A 14: 41,980,066 I154F probably damaging Het
Gm4565 T A 7: 22,583,370 M8L probably benign Het
Gpr179 T C 11: 97,349,790 Q269R probably benign Het
Ikzf2 T C 1: 69,538,901 H483R possibly damaging Het
Il25 G A 14: 54,933,158 A63T probably benign Het
Krt27 T A 11: 99,346,814 N366I probably benign Het
Mfge8 A G 7: 79,142,520 V219A probably benign Het
Nrbp1 T C 5: 31,249,946 V373A probably damaging Het
Olfr1186 A G 2: 88,526,486 N301S probably benign Het
Pcdh20 A G 14: 88,469,171 I231T probably damaging Het
Pfkp A G 13: 6,581,567 W151R probably damaging Het
Pikfyve T C 1: 65,246,854 I1084T probably benign Het
Poteg T C 8: 27,449,895 C27R probably damaging Het
Ptprz1 G A 6: 23,044,346 V1266M probably damaging Het
Rpa1 T C 11: 75,312,802 D358G probably damaging Het
Snapc4 A G 2: 26,369,953 S495P probably damaging Het
Surf6 A G 2: 26,899,356 I123T probably damaging Het
Sybu A T 15: 44,677,695 S324T possibly damaging Het
Trim3 A T 7: 105,618,214 S319R probably damaging Het
Trmt11 A G 10: 30,590,934 F72L probably benign Het
Tsks C T 7: 44,943,792 R61W probably damaging Het
Ube2k T C 5: 65,581,429 V36A possibly damaging Het
Ube3a T C 7: 59,288,413 V688A probably damaging Het
Vegfc A G 8: 54,157,045 K79E possibly damaging Het
Vmn1r77 G A 7: 12,041,834 R179Q probably benign Het
Vmn2r97 T A 17: 18,914,367 F16I probably benign Het
Zfp451 A T 1: 33,802,167 probably benign Het
Zfp600 C T 4: 146,195,322 Q187* probably null Het
Other mutations in Hfe2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01671:Hfe2 APN 3 96528491 missense probably damaging 1.00
IGL02342:Hfe2 APN 3 96528172 missense possibly damaging 0.78
IGL03083:Hfe2 APN 3 96528606 missense probably benign 0.41
PIT4354001:Hfe2 UTSW 3 96528445 missense probably damaging 1.00
PIT4504001:Hfe2 UTSW 3 96528497 missense probably damaging 1.00
R4602:Hfe2 UTSW 3 96527553 missense probably benign 0.02
R5475:Hfe2 UTSW 3 96527283 missense probably benign 0.19
R5761:Hfe2 UTSW 3 96528622 missense probably benign 0.00
R7117:Hfe2 UTSW 3 96528226 missense possibly damaging 0.95
R7206:Hfe2 UTSW 3 96528128 missense probably damaging 1.00
Z1177:Hfe2 UTSW 3 96527197 missense possibly damaging 0.88
Z1177:Hfe2 UTSW 3 96528087 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGGACCTGATGATCCAGCAC -3'
(R):5'- TTGATGGAAGGAAGCCATTCAG -3'

Sequencing Primer
(F):5'- TGATGATCCAGCACAACTGC -3'
(R):5'- CATTCAGGATGGAAGGGAATGTTTG -3'
Posted On2019-05-13