Incidental Mutation 'R7044:Zfp600'
ID547202
Institutional Source Beutler Lab
Gene Symbol Zfp600
Ensembl Gene ENSMUSG00000066007
Gene Namezinc finger protein 600
SynonymsGm13164
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.500) question?
Stock #R7044 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location146156824-146198755 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 146195322 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 187 (Q187*)
Ref Sequence ENSEMBL: ENSMUSP00000126879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092750] [ENSMUST00000131932] [ENSMUST00000168483]
Predicted Effect probably null
Transcript: ENSMUST00000092750
AA Change: Q187*
SMART Domains Protein: ENSMUSP00000090425
Gene: ENSMUSG00000066007
AA Change: Q187*

DomainStartEndE-ValueType
KRAB 28 90 1.29e-17 SMART
ZnF_C2H2 251 273 7.9e-4 SMART
ZnF_C2H2 279 301 7.9e-4 SMART
ZnF_C2H2 307 329 3.49e-5 SMART
ZnF_C2H2 335 357 1.95e-3 SMART
ZnF_C2H2 363 385 7.9e-4 SMART
ZnF_C2H2 391 413 7.9e-4 SMART
ZnF_C2H2 419 441 3.49e-5 SMART
ZnF_C2H2 447 469 3.89e-3 SMART
ZnF_C2H2 475 497 2.75e-3 SMART
ZnF_C2H2 503 525 3.04e-5 SMART
ZnF_C2H2 531 553 8.34e-3 SMART
ZnF_C2H2 559 581 5.67e-5 SMART
ZnF_C2H2 587 609 1.98e-4 SMART
ZnF_C2H2 615 637 5.29e-5 SMART
ZnF_C2H2 643 665 1.58e-3 SMART
ZnF_C2H2 671 693 1.28e-3 SMART
ZnF_C2H2 699 721 1.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131932
SMART Domains Protein: ENSMUSP00000117892
Gene: ENSMUSG00000066007

DomainStartEndE-ValueType
KRAB 28 90 1.29e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000168483
AA Change: Q187*
SMART Domains Protein: ENSMUSP00000126879
Gene: ENSMUSG00000066007
AA Change: Q187*

DomainStartEndE-ValueType
KRAB 28 90 1.29e-17 SMART
ZnF_C2H2 251 273 7.9e-4 SMART
ZnF_C2H2 279 301 7.9e-4 SMART
ZnF_C2H2 307 329 3.49e-5 SMART
ZnF_C2H2 335 357 1.95e-3 SMART
ZnF_C2H2 363 385 7.9e-4 SMART
ZnF_C2H2 391 413 7.9e-4 SMART
ZnF_C2H2 419 441 3.49e-5 SMART
ZnF_C2H2 447 469 3.89e-3 SMART
ZnF_C2H2 475 497 2.75e-3 SMART
ZnF_C2H2 503 525 3.04e-5 SMART
ZnF_C2H2 531 553 8.34e-3 SMART
ZnF_C2H2 559 581 5.67e-5 SMART
ZnF_C2H2 587 609 1.98e-4 SMART
ZnF_C2H2 615 637 5.29e-5 SMART
ZnF_C2H2 643 665 1.58e-3 SMART
ZnF_C2H2 671 693 1.28e-3 SMART
ZnF_C2H2 699 721 1.6e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,612,280 D1169N possibly damaging Het
Ankrd6 T A 4: 32,815,260 Q448L possibly damaging Het
Appl1 A G 14: 26,928,677 S513P possibly damaging Het
Cdhr2 A T 13: 54,733,321 K1066* probably null Het
Ckap5 T C 2: 91,577,601 I824T probably benign Het
Ctbp2 T C 7: 133,015,102 R35G possibly damaging Het
Dcdc2c T C 12: 28,470,494 probably benign Het
Eya1 T A 1: 14,231,410 probably null Het
Fam105a A G 15: 27,657,235 probably benign Het
Fam207a T C 10: 77,514,392 D35G possibly damaging Het
Fat4 G C 3: 39,010,810 A4972P probably benign Het
Fat4 C T 3: 39,010,811 A4972V probably benign Het
Fbxl8 T A 8: 105,267,015 M1K probably null Het
Glyat T C 19: 12,650,265 S75P probably benign Het
Gm3543 T A 14: 41,980,066 I154F probably damaging Het
Gm4565 T A 7: 22,583,370 M8L probably benign Het
Gpr179 T C 11: 97,349,790 Q269R probably benign Het
Hfe2 C A 3: 96,527,474 H176Q possibly damaging Het
Ikzf2 T C 1: 69,538,901 H483R possibly damaging Het
Il25 G A 14: 54,933,158 A63T probably benign Het
Krt27 T A 11: 99,346,814 N366I probably benign Het
Mfge8 A G 7: 79,142,520 V219A probably benign Het
Nrbp1 T C 5: 31,249,946 V373A probably damaging Het
Olfr1186 A G 2: 88,526,486 N301S probably benign Het
Pcdh20 A G 14: 88,469,171 I231T probably damaging Het
Pfkp A G 13: 6,581,567 W151R probably damaging Het
Pikfyve T C 1: 65,246,854 I1084T probably benign Het
Poteg T C 8: 27,449,895 C27R probably damaging Het
Ptprz1 G A 6: 23,044,346 V1266M probably damaging Het
Rpa1 T C 11: 75,312,802 D358G probably damaging Het
Snapc4 A G 2: 26,369,953 S495P probably damaging Het
Surf6 A G 2: 26,899,356 I123T probably damaging Het
Sybu A T 15: 44,677,695 S324T possibly damaging Het
Trim3 A T 7: 105,618,214 S319R probably damaging Het
Trmt11 A G 10: 30,590,934 F72L probably benign Het
Tsks C T 7: 44,943,792 R61W probably damaging Het
Ube2k T C 5: 65,581,429 V36A possibly damaging Het
Ube3a T C 7: 59,288,413 V688A probably damaging Het
Vegfc A G 8: 54,157,045 K79E possibly damaging Het
Vmn1r77 G A 7: 12,041,834 R179Q probably benign Het
Vmn2r97 T A 17: 18,914,367 F16I probably benign Het
Zfp451 A T 1: 33,802,167 probably benign Het
Other mutations in Zfp600
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4131001:Zfp600 UTSW 4 146195232 frame shift probably null
R1004:Zfp600 UTSW 4 146196533 unclassified probably benign
R1323:Zfp600 UTSW 4 146196691 missense probably damaging 1.00
R1323:Zfp600 UTSW 4 146196691 missense probably damaging 1.00
R1702:Zfp600 UTSW 4 146196927 missense probably benign 0.04
R2165:Zfp600 UTSW 4 146196918 nonsense probably null
R5238:Zfp600 UTSW 4 146195171 splice site probably null
R5548:Zfp600 UTSW 4 146196449 missense possibly damaging 0.86
R5646:Zfp600 UTSW 4 146195100 missense probably damaging 1.00
R5948:Zfp600 UTSW 4 146195075 missense probably damaging 0.96
R6112:Zfp600 UTSW 4 146195131 missense probably benign 0.41
R7836:Zfp600 UTSW 4 146196953 missense probably benign
R8080:Zfp600 UTSW 4 146196612 missense unknown
Z1176:Zfp600 UTSW 4 146196639 missense unknown
Z1177:Zfp600 UTSW 4 146196763 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGATGCCACTCTCCAATCC -3'
(R):5'- TGTCGCATTCACTACATTTGTAAGG -3'

Sequencing Primer
(F):5'- GATGCCACTCTCCAATCCTCAAAC -3'
(R):5'- CATTTGTAAGGTTTCTCTCCTGAATG -3'
Posted On2019-05-13