Incidental Mutation 'R7044:Zfp600'
ID 547202
Institutional Source Beutler Lab
Gene Symbol Zfp600
Ensembl Gene ENSMUSG00000066007
Gene Name zinc finger protein 600
Synonyms Gm13164
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.534) question?
Stock # R7044 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 146156824-146198755 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 146195322 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 187 (Q187*)
Ref Sequence ENSEMBL: ENSMUSP00000126879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092750] [ENSMUST00000131932] [ENSMUST00000168483]
AlphaFold A2A7V0
Predicted Effect probably null
Transcript: ENSMUST00000092750
AA Change: Q187*
SMART Domains Protein: ENSMUSP00000090425
Gene: ENSMUSG00000066007
AA Change: Q187*

DomainStartEndE-ValueType
KRAB 28 90 1.29e-17 SMART
ZnF_C2H2 251 273 7.9e-4 SMART
ZnF_C2H2 279 301 7.9e-4 SMART
ZnF_C2H2 307 329 3.49e-5 SMART
ZnF_C2H2 335 357 1.95e-3 SMART
ZnF_C2H2 363 385 7.9e-4 SMART
ZnF_C2H2 391 413 7.9e-4 SMART
ZnF_C2H2 419 441 3.49e-5 SMART
ZnF_C2H2 447 469 3.89e-3 SMART
ZnF_C2H2 475 497 2.75e-3 SMART
ZnF_C2H2 503 525 3.04e-5 SMART
ZnF_C2H2 531 553 8.34e-3 SMART
ZnF_C2H2 559 581 5.67e-5 SMART
ZnF_C2H2 587 609 1.98e-4 SMART
ZnF_C2H2 615 637 5.29e-5 SMART
ZnF_C2H2 643 665 1.58e-3 SMART
ZnF_C2H2 671 693 1.28e-3 SMART
ZnF_C2H2 699 721 1.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131932
SMART Domains Protein: ENSMUSP00000117892
Gene: ENSMUSG00000066007

DomainStartEndE-ValueType
KRAB 28 90 1.29e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000168483
AA Change: Q187*
SMART Domains Protein: ENSMUSP00000126879
Gene: ENSMUSG00000066007
AA Change: Q187*

DomainStartEndE-ValueType
KRAB 28 90 1.29e-17 SMART
ZnF_C2H2 251 273 7.9e-4 SMART
ZnF_C2H2 279 301 7.9e-4 SMART
ZnF_C2H2 307 329 3.49e-5 SMART
ZnF_C2H2 335 357 1.95e-3 SMART
ZnF_C2H2 363 385 7.9e-4 SMART
ZnF_C2H2 391 413 7.9e-4 SMART
ZnF_C2H2 419 441 3.49e-5 SMART
ZnF_C2H2 447 469 3.89e-3 SMART
ZnF_C2H2 475 497 2.75e-3 SMART
ZnF_C2H2 503 525 3.04e-5 SMART
ZnF_C2H2 531 553 8.34e-3 SMART
ZnF_C2H2 559 581 5.67e-5 SMART
ZnF_C2H2 587 609 1.98e-4 SMART
ZnF_C2H2 615 637 5.29e-5 SMART
ZnF_C2H2 643 665 1.58e-3 SMART
ZnF_C2H2 671 693 1.28e-3 SMART
ZnF_C2H2 699 721 1.6e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,612,280 D1169N possibly damaging Het
Ankrd6 T A 4: 32,815,260 Q448L possibly damaging Het
Appl1 A G 14: 26,928,677 S513P possibly damaging Het
Cdhr2 A T 13: 54,733,321 K1066* probably null Het
Ckap5 T C 2: 91,577,601 I824T probably benign Het
Ctbp2 T C 7: 133,015,102 R35G possibly damaging Het
Dcdc2c T C 12: 28,470,494 probably benign Het
Eya1 T A 1: 14,231,410 probably null Het
Fam105a A G 15: 27,657,235 probably benign Het
Fam207a T C 10: 77,514,392 D35G possibly damaging Het
Fat4 G C 3: 39,010,810 A4972P probably benign Het
Fat4 C T 3: 39,010,811 A4972V probably benign Het
Fbxl8 T A 8: 105,267,015 M1K probably null Het
Glyat T C 19: 12,650,265 S75P probably benign Het
Gm3543 T A 14: 41,980,066 I154F probably damaging Het
Gm4565 T A 7: 22,583,370 M8L probably benign Het
Gpr179 T C 11: 97,349,790 Q269R probably benign Het
Hfe2 C A 3: 96,527,474 H176Q possibly damaging Het
Ikzf2 T C 1: 69,538,901 H483R possibly damaging Het
Il25 G A 14: 54,933,158 A63T probably benign Het
Krt27 T A 11: 99,346,814 N366I probably benign Het
Mfge8 A G 7: 79,142,520 V219A probably benign Het
Nrbp1 T C 5: 31,249,946 V373A probably damaging Het
Olfr1186 A G 2: 88,526,486 N301S probably benign Het
Pcdh20 A G 14: 88,469,171 I231T probably damaging Het
Pfkp A G 13: 6,581,567 W151R probably damaging Het
Pikfyve T C 1: 65,246,854 I1084T probably benign Het
Poteg T C 8: 27,449,895 C27R probably damaging Het
Ptprz1 G A 6: 23,044,346 V1266M probably damaging Het
Rpa1 T C 11: 75,312,802 D358G probably damaging Het
Snapc4 A G 2: 26,369,953 S495P probably damaging Het
Surf6 A G 2: 26,899,356 I123T probably damaging Het
Sybu A T 15: 44,677,695 S324T possibly damaging Het
Trim3 A T 7: 105,618,214 S319R probably damaging Het
Trmt11 A G 10: 30,590,934 F72L probably benign Het
Tsks C T 7: 44,943,792 R61W probably damaging Het
Ube2k T C 5: 65,581,429 V36A possibly damaging Het
Ube3a T C 7: 59,288,413 V688A probably damaging Het
Vegfc A G 8: 54,157,045 K79E possibly damaging Het
Vmn1r77 G A 7: 12,041,834 R179Q probably benign Het
Vmn2r97 T A 17: 18,914,367 F16I probably benign Het
Zfp451 A T 1: 33,802,167 probably benign Het
Other mutations in Zfp600
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4131001:Zfp600 UTSW 4 146195232 frame shift probably null
R1004:Zfp600 UTSW 4 146196533 unclassified probably benign
R1323:Zfp600 UTSW 4 146196691 missense probably damaging 1.00
R1323:Zfp600 UTSW 4 146196691 missense probably damaging 1.00
R1702:Zfp600 UTSW 4 146196927 missense probably benign 0.04
R2165:Zfp600 UTSW 4 146196918 nonsense probably null
R5238:Zfp600 UTSW 4 146195171 splice site probably null
R5548:Zfp600 UTSW 4 146196449 missense possibly damaging 0.86
R5646:Zfp600 UTSW 4 146195100 missense probably damaging 1.00
R5948:Zfp600 UTSW 4 146195075 missense probably damaging 0.96
R6112:Zfp600 UTSW 4 146195131 missense probably benign 0.41
R7836:Zfp600 UTSW 4 146196953 missense probably benign
R8080:Zfp600 UTSW 4 146196612 missense unknown
R8749:Zfp600 UTSW 4 146196581 missense unknown
R9255:Zfp600 UTSW 4 146195103 missense possibly damaging 0.70
Z1176:Zfp600 UTSW 4 146196639 missense unknown
Z1177:Zfp600 UTSW 4 146196763 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGATGCCACTCTCCAATCC -3'
(R):5'- TGTCGCATTCACTACATTTGTAAGG -3'

Sequencing Primer
(F):5'- GATGCCACTCTCCAATCCTCAAAC -3'
(R):5'- CATTTGTAAGGTTTCTCTCCTGAATG -3'
Posted On 2019-05-13