Incidental Mutation 'R7044:Ube2k'
ID547204
Institutional Source Beutler Lab
Gene Symbol Ube2k
Ensembl Gene ENSMUSG00000029203
Gene Nameubiquitin-conjugating enzyme E2K
SynonymsD5Ertd601e, Hip2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R7044 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location65537233-65598988 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65581429 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 36 (V36A)
Ref Sequence ENSEMBL: ENSMUSP00000143941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000142407] [ENSMUST00000200946] [ENSMUST00000201266] [ENSMUST00000201292] [ENSMUST00000201383] [ENSMUST00000201984] [ENSMUST00000202082] [ENSMUST00000202601] [ENSMUST00000202679]
Predicted Effect possibly damaging
Transcript: ENSMUST00000142407
AA Change: V87A

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122471
Gene: ENSMUSG00000029203
AA Change: V87A

DomainStartEndE-ValueType
UBCc 7 154 7.7e-70 SMART
UBA 162 199 3.1e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200946
SMART Domains Protein: ENSMUSP00000144308
Gene: ENSMUSG00000029203

DomainStartEndE-ValueType
Pfam:UQ_con 1 46 6.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201266
SMART Domains Protein: ENSMUSP00000144192
Gene: ENSMUSG00000029203

DomainStartEndE-ValueType
UBCc 7 93 5.86e-4 SMART
UBA 101 138 3.1e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201292
SMART Domains Protein: ENSMUSP00000144060
Gene: ENSMUSG00000029203

DomainStartEndE-ValueType
Pfam:UQ_con 1 46 1.4e-9 PFAM
UBA 59 96 3.1e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201383
AA Change: V87A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000144580
Gene: ENSMUSG00000029203
AA Change: V87A

DomainStartEndE-ValueType
UBCc 7 146 2.73e-52 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000201984
AA Change: V36A

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143941
Gene: ENSMUSG00000029203
AA Change: V36A

DomainStartEndE-ValueType
UBCc 7 103 9.94e-23 SMART
UBA 111 148 3.1e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202082
SMART Domains Protein: ENSMUSP00000144428
Gene: ENSMUSG00000029203

DomainStartEndE-ValueType
Pfam:UQ_con 1 46 1.4e-9 PFAM
UBA 59 96 3.1e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202601
SMART Domains Protein: ENSMUSP00000144619
Gene: ENSMUSG00000029203

DomainStartEndE-ValueType
Pfam:UQ_con 8 57 9.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202679
SMART Domains Protein: ENSMUSP00000144366
Gene: ENSMUSG00000029203

DomainStartEndE-ValueType
Pfam:UQ_con 1 46 1.4e-9 PFAM
UBA 59 96 3.1e-11 SMART
Meta Mutation Damage Score 0.0715 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ubiquitin-conjugating enzyme family. This protein interacts with RING finger proteins, and it can ubiquitinate huntingtin, the gene product for Huntington's disease. Known functions for this protein include a role in aggregate formation of expanded polyglutamine proteins and the suppression of apoptosis in polyglutamine diseases, a role in the dislocation of newly synthesized MHC class I heavy chains from the endoplasmic reticulum, and involvement in foam cell formation. Multiple transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit resistance to amyloid-beta neurotoxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,612,280 D1169N possibly damaging Het
Ankrd6 T A 4: 32,815,260 Q448L possibly damaging Het
Appl1 A G 14: 26,928,677 S513P possibly damaging Het
Cdhr2 A T 13: 54,733,321 K1066* probably null Het
Ckap5 T C 2: 91,577,601 I824T probably benign Het
Ctbp2 T C 7: 133,015,102 R35G possibly damaging Het
Dcdc2c T C 12: 28,470,494 probably benign Het
Eya1 T A 1: 14,231,410 probably null Het
Fam105a A G 15: 27,657,235 probably benign Het
Fam207a T C 10: 77,514,392 D35G possibly damaging Het
Fat4 G C 3: 39,010,810 A4972P probably benign Het
Fat4 C T 3: 39,010,811 A4972V probably benign Het
Fbxl8 T A 8: 105,267,015 M1K probably null Het
Glyat T C 19: 12,650,265 S75P probably benign Het
Gm3543 T A 14: 41,980,066 I154F probably damaging Het
Gm4565 T A 7: 22,583,370 M8L probably benign Het
Gpr179 T C 11: 97,349,790 Q269R probably benign Het
Hfe2 C A 3: 96,527,474 H176Q possibly damaging Het
Ikzf2 T C 1: 69,538,901 H483R possibly damaging Het
Il25 G A 14: 54,933,158 A63T probably benign Het
Krt27 T A 11: 99,346,814 N366I probably benign Het
Mfge8 A G 7: 79,142,520 V219A probably benign Het
Nrbp1 T C 5: 31,249,946 V373A probably damaging Het
Olfr1186 A G 2: 88,526,486 N301S probably benign Het
Pcdh20 A G 14: 88,469,171 I231T probably damaging Het
Pfkp A G 13: 6,581,567 W151R probably damaging Het
Pikfyve T C 1: 65,246,854 I1084T probably benign Het
Poteg T C 8: 27,449,895 C27R probably damaging Het
Ptprz1 G A 6: 23,044,346 V1266M probably damaging Het
Rpa1 T C 11: 75,312,802 D358G probably damaging Het
Snapc4 A G 2: 26,369,953 S495P probably damaging Het
Surf6 A G 2: 26,899,356 I123T probably damaging Het
Sybu A T 15: 44,677,695 S324T possibly damaging Het
Trim3 A T 7: 105,618,214 S319R probably damaging Het
Trmt11 A G 10: 30,590,934 F72L probably benign Het
Tsks C T 7: 44,943,792 R61W probably damaging Het
Ube3a T C 7: 59,288,413 V688A probably damaging Het
Vegfc A G 8: 54,157,045 K79E possibly damaging Het
Vmn1r77 G A 7: 12,041,834 R179Q probably benign Het
Vmn2r97 T A 17: 18,914,367 F16I probably benign Het
Zfp451 A T 1: 33,802,167 probably benign Het
Zfp600 C T 4: 146,195,322 Q187* probably null Het
Other mutations in Ube2k
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0733:Ube2k UTSW 5 65581452 missense probably damaging 0.99
R2129:Ube2k UTSW 5 65594926 missense probably damaging 0.97
R5752:Ube2k UTSW 5 65566068 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTGGTTTGCACCTTAC -3'
(R):5'- CAAAACAACTTTGGACATCTCTTGC -3'

Sequencing Primer
(F):5'- GGTTTGCACCTTACTATCATTTAATG -3'
(R):5'- AGCTTTCTAACAAAGAAGGA -3'
Posted On2019-05-13