Incidental Mutation 'R7044:Ube3a'
ID547209
Institutional Source Beutler Lab
Gene Symbol Ube3a
Ensembl Gene ENSMUSG00000025326
Gene Nameubiquitin protein ligase E3A
SynonymsHpve6a, 5830462N02Rik, E6-AP ubiquitin protein ligase, A130086L21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.577) question?
Stock #R7044 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location59228750-59311536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59288413 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 688 (V688A)
Ref Sequence ENSEMBL: ENSMUSP00000143962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107537] [ENSMUST00000200758] [ENSMUST00000202945]
Predicted Effect probably damaging
Transcript: ENSMUST00000107537
AA Change: V688A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103161
Gene: ENSMUSG00000025326
AA Change: V688A

DomainStartEndE-ValueType
Pfam:AZUL 27 81 1.7e-21 PFAM
Blast:HECTc 108 169 2e-20 BLAST
low complexity region 170 207 N/A INTRINSIC
Blast:HECTc 359 480 1e-12 BLAST
HECTc 540 870 5.05e-180 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200758
AA Change: V709A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143859
Gene: ENSMUSG00000025326
AA Change: V709A

DomainStartEndE-ValueType
Pfam:AZUL 27 81 1.7e-21 PFAM
Blast:HECTc 108 169 2e-20 BLAST
low complexity region 170 207 N/A INTRINSIC
Blast:HECTc 359 480 1e-12 BLAST
HECTc 540 870 5.05e-180 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000202288
Predicted Effect probably damaging
Transcript: ENSMUST00000202945
AA Change: V688A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143962
Gene: ENSMUSG00000025326
AA Change: V688A

DomainStartEndE-ValueType
Pfam:AZUL 6 60 4.4e-21 PFAM
Blast:HECTc 87 148 2e-20 BLAST
low complexity region 149 186 N/A INTRINSIC
Blast:HECTc 338 459 1e-12 BLAST
HECTc 519 762 7.07e-79 SMART
Meta Mutation Damage Score 0.9560 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase, part of the ubiquitin protein degradation system. This imprinted gene is maternally expressed in brain and biallelically expressed in other tissues. Maternally inherited deletion of this gene causes Angelman Syndrome, characterized by severe motor and intellectual retardation, ataxia, hypotonia, epilepsy, absence of speech, and characteristic facies. The protein also interacts with the E6 protein of human papillomavirus types 16 and 18, resulting in ubiquitination and proteolysis of tumor protein p53. Alternative splicing of this gene results in three transcript variants encoding three isoforms with different N-termini. Additional transcript variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with maternally inherited targeted null mutations exhibit reduced brain weight, impaired motor function, inducible seizures, learning deficits, abnormal hippocampal electroencephalographic recordings, and severely impaired long-term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,612,280 D1169N possibly damaging Het
Ankrd6 T A 4: 32,815,260 Q448L possibly damaging Het
Appl1 A G 14: 26,928,677 S513P possibly damaging Het
Cdhr2 A T 13: 54,733,321 K1066* probably null Het
Ckap5 T C 2: 91,577,601 I824T probably benign Het
Ctbp2 T C 7: 133,015,102 R35G possibly damaging Het
Dcdc2c T C 12: 28,470,494 probably benign Het
Eya1 T A 1: 14,231,410 probably null Het
Fam105a A G 15: 27,657,235 probably benign Het
Fam207a T C 10: 77,514,392 D35G possibly damaging Het
Fat4 G C 3: 39,010,810 A4972P probably benign Het
Fat4 C T 3: 39,010,811 A4972V probably benign Het
Fbxl8 T A 8: 105,267,015 M1K probably null Het
Glyat T C 19: 12,650,265 S75P probably benign Het
Gm3543 T A 14: 41,980,066 I154F probably damaging Het
Gm4565 T A 7: 22,583,370 M8L probably benign Het
Gpr179 T C 11: 97,349,790 Q269R probably benign Het
Hfe2 C A 3: 96,527,474 H176Q possibly damaging Het
Ikzf2 T C 1: 69,538,901 H483R possibly damaging Het
Il25 G A 14: 54,933,158 A63T probably benign Het
Krt27 T A 11: 99,346,814 N366I probably benign Het
Mfge8 A G 7: 79,142,520 V219A probably benign Het
Nrbp1 T C 5: 31,249,946 V373A probably damaging Het
Olfr1186 A G 2: 88,526,486 N301S probably benign Het
Pcdh20 A G 14: 88,469,171 I231T probably damaging Het
Pfkp A G 13: 6,581,567 W151R probably damaging Het
Pikfyve T C 1: 65,246,854 I1084T probably benign Het
Poteg T C 8: 27,449,895 C27R probably damaging Het
Ptprz1 G A 6: 23,044,346 V1266M probably damaging Het
Rpa1 T C 11: 75,312,802 D358G probably damaging Het
Snapc4 A G 2: 26,369,953 S495P probably damaging Het
Surf6 A G 2: 26,899,356 I123T probably damaging Het
Sybu A T 15: 44,677,695 S324T possibly damaging Het
Trim3 A T 7: 105,618,214 S319R probably damaging Het
Trmt11 A G 10: 30,590,934 F72L probably benign Het
Tsks C T 7: 44,943,792 R61W probably damaging Het
Ube2k T C 5: 65,581,429 V36A possibly damaging Het
Vegfc A G 8: 54,157,045 K79E possibly damaging Het
Vmn1r77 G A 7: 12,041,834 R179Q probably benign Het
Vmn2r97 T A 17: 18,914,367 F16I probably benign Het
Zfp451 A T 1: 33,802,167 probably benign Het
Zfp600 C T 4: 146,195,322 Q187* probably null Het
Other mutations in Ube3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Ube3a APN 7 59272110 missense probably damaging 1.00
IGL00886:Ube3a APN 7 59284737 missense probably damaging 1.00
IGL02037:Ube3a APN 7 59275758 unclassified probably benign
IGL02127:Ube3a APN 7 59276041 missense probably benign 0.03
IGL02228:Ube3a APN 7 59288396 splice site probably benign
IGL02533:Ube3a APN 7 59304832 missense probably damaging 1.00
IGL02706:Ube3a APN 7 59272133 missense possibly damaging 0.67
IGL03037:Ube3a APN 7 59247223 splice site probably benign
IGL03213:Ube3a APN 7 59286122 nonsense probably null
IGL03306:Ube3a APN 7 59286147 missense probably damaging 1.00
Kebab UTSW 7 59288488 missense probably damaging 1.00
Shawarma UTSW 7 59276183 nonsense probably null
PIT4362001:Ube3a UTSW 7 59276122 missense possibly damaging 0.86
R0847:Ube3a UTSW 7 59276586 missense possibly damaging 0.80
R1765:Ube3a UTSW 7 59286114 missense probably damaging 1.00
R1771:Ube3a UTSW 7 59275966 missense probably damaging 1.00
R1926:Ube3a UTSW 7 59276379 missense probably damaging 1.00
R1992:Ube3a UTSW 7 59303787 missense probably damaging 1.00
R2026:Ube3a UTSW 7 59303726 missense probably damaging 1.00
R2104:Ube3a UTSW 7 59276477 missense possibly damaging 0.95
R3176:Ube3a UTSW 7 59276519 nonsense probably null
R3276:Ube3a UTSW 7 59276519 nonsense probably null
R3623:Ube3a UTSW 7 59272112 missense probably damaging 1.00
R3624:Ube3a UTSW 7 59272112 missense probably damaging 1.00
R3690:Ube3a UTSW 7 59276799 missense probably damaging 1.00
R4423:Ube3a UTSW 7 59276113 missense probably benign 0.10
R4583:Ube3a UTSW 7 59286063 missense probably damaging 1.00
R4883:Ube3a UTSW 7 59243450 start codon destroyed probably benign 0.21
R4992:Ube3a UTSW 7 59284820 missense possibly damaging 0.47
R5175:Ube3a UTSW 7 59288717 missense probably damaging 1.00
R5397:Ube3a UTSW 7 59286912 missense probably benign 0.26
R5545:Ube3a UTSW 7 59272024 missense probably damaging 1.00
R5572:Ube3a UTSW 7 59288777 missense probably damaging 1.00
R5635:Ube3a UTSW 7 59288488 missense probably damaging 1.00
R5766:Ube3a UTSW 7 59276059 missense possibly damaging 0.89
R5890:Ube3a UTSW 7 59272028 missense probably damaging 1.00
R5956:Ube3a UTSW 7 59277020 unclassified probably benign
R6388:Ube3a UTSW 7 59304921 unclassified probably null
R6464:Ube3a UTSW 7 59276183 nonsense probably null
R6467:Ube3a UTSW 7 59276902 missense probably damaging 1.00
R6474:Ube3a UTSW 7 59287024 missense probably damaging 1.00
R6669:Ube3a UTSW 7 59276857 missense probably benign 0.02
R7003:Ube3a UTSW 7 59276440 missense probably damaging 1.00
R7187:Ube3a UTSW 7 59275905 missense probably benign 0.02
R7360:Ube3a UTSW 7 59276635 missense probably damaging 1.00
R7363:Ube3a UTSW 7 59287003 missense probably benign 0.00
R7508:Ube3a UTSW 7 59303689 missense possibly damaging 0.84
R7652:Ube3a UTSW 7 59243354 start gained probably benign
R7768:Ube3a UTSW 7 59288777 missense probably damaging 1.00
R8015:Ube3a UTSW 7 59284756 missense probably damaging 1.00
R8044:Ube3a UTSW 7 59276572 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- TTAAGCACTGAACCAACTCTCTG -3'
(R):5'- TAGTGCCTGGAAATCTAGATTCTG -3'

Sequencing Primer
(F):5'- GCACTGAACCAACTCTCTGAAATC -3'
(R):5'- GCACCTTAACATCCATAGTACAC -3'
Posted On2019-05-13