Incidental Mutation 'R7044:Ctbp2'
ID547212
Institutional Source Beutler Lab
Gene Symbol Ctbp2
Ensembl Gene ENSMUSG00000030970
Gene NameC-terminal binding protein 2
SynonymsD7Ertd45e, Gtrgeo6, Ribeye
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7044 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location132987563-133124354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133015102 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 35 (R35G)
Ref Sequence ENSEMBL: ENSMUSP00000130294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033269] [ENSMUST00000124096] [ENSMUST00000163601] [ENSMUST00000165457] [ENSMUST00000166439] [ENSMUST00000167218] [ENSMUST00000168958] [ENSMUST00000169570] [ENSMUST00000170459] [ENSMUST00000172341]
Predicted Effect probably benign
Transcript: ENSMUST00000033269
SMART Domains Protein: ENSMUSP00000033269
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 36 358 2.9e-31 PFAM
Pfam:2-Hacid_dh_C 139 323 1.7e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163601
Predicted Effect possibly damaging
Transcript: ENSMUST00000165457
AA Change: R35G

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000166439
SMART Domains Protein: ENSMUSP00000127448
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 11 333 2.4e-31 PFAM
Pfam:2-Hacid_dh_C 114 298 1.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167218
Predicted Effect probably benign
Transcript: ENSMUST00000168958
SMART Domains Protein: ENSMUSP00000132892
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 19 164 6.3e-27 PFAM
Pfam:2-Hacid_dh_C 122 188 8.5e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169570
AA Change: R35G

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130294
Gene: ENSMUSG00000030970
AA Change: R35G

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 579 901 2.8e-31 PFAM
Pfam:2-Hacid_dh_C 682 866 5.6e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170459
Predicted Effect probably benign
Transcript: ENSMUST00000172341
SMART Domains Protein: ENSMUSP00000127701
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 36 177 5.6e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene produces alternative transcripts encoding two distinct proteins. One protein is a transcriptional repressor, while the other isoform is a major component of specialized synapses known as synaptic ribbons. Both proteins contain a NAD+ binding domain similar to NAD+-dependent 2-hydroxyacid dehydrogenases. A portion of the 3' untranslated region was used to map this gene to chromosome 21q21.3; however, it was noted that similar loci elsewhere in the genome are likely. Blast analysis shows that this gene is present on chromosome 10. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Embryos homozygous for a gene-trapped allele die by E10 exhibiting a small size, axial truncations, a thin neural epithelium, a dilated pericardium, delayed fore- and midbrain development, and defects in heart morphogenesis, placental development and extraembryonic vascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,612,280 D1169N possibly damaging Het
Ankrd6 T A 4: 32,815,260 Q448L possibly damaging Het
Appl1 A G 14: 26,928,677 S513P possibly damaging Het
Cdhr2 A T 13: 54,733,321 K1066* probably null Het
Ckap5 T C 2: 91,577,601 I824T probably benign Het
Dcdc2c T C 12: 28,470,494 probably benign Het
Eya1 T A 1: 14,231,410 probably null Het
Fam105a A G 15: 27,657,235 probably benign Het
Fam207a T C 10: 77,514,392 D35G possibly damaging Het
Fat4 G C 3: 39,010,810 A4972P probably benign Het
Fat4 C T 3: 39,010,811 A4972V probably benign Het
Fbxl8 T A 8: 105,267,015 M1K probably null Het
Glyat T C 19: 12,650,265 S75P probably benign Het
Gm3543 T A 14: 41,980,066 I154F probably damaging Het
Gm4565 T A 7: 22,583,370 M8L probably benign Het
Gpr179 T C 11: 97,349,790 Q269R probably benign Het
Hfe2 C A 3: 96,527,474 H176Q possibly damaging Het
Ikzf2 T C 1: 69,538,901 H483R possibly damaging Het
Il25 G A 14: 54,933,158 A63T probably benign Het
Krt27 T A 11: 99,346,814 N366I probably benign Het
Mfge8 A G 7: 79,142,520 V219A probably benign Het
Nrbp1 T C 5: 31,249,946 V373A probably damaging Het
Olfr1186 A G 2: 88,526,486 N301S probably benign Het
Pcdh20 A G 14: 88,469,171 I231T probably damaging Het
Pfkp A G 13: 6,581,567 W151R probably damaging Het
Pikfyve T C 1: 65,246,854 I1084T probably benign Het
Poteg T C 8: 27,449,895 C27R probably damaging Het
Ptprz1 G A 6: 23,044,346 V1266M probably damaging Het
Rpa1 T C 11: 75,312,802 D358G probably damaging Het
Snapc4 A G 2: 26,369,953 S495P probably damaging Het
Surf6 A G 2: 26,899,356 I123T probably damaging Het
Sybu A T 15: 44,677,695 S324T possibly damaging Het
Trim3 A T 7: 105,618,214 S319R probably damaging Het
Trmt11 A G 10: 30,590,934 F72L probably benign Het
Tsks C T 7: 44,943,792 R61W probably damaging Het
Ube2k T C 5: 65,581,429 V36A possibly damaging Het
Ube3a T C 7: 59,288,413 V688A probably damaging Het
Vegfc A G 8: 54,157,045 K79E possibly damaging Het
Vmn1r77 G A 7: 12,041,834 R179Q probably benign Het
Vmn2r97 T A 17: 18,914,367 F16I probably benign Het
Zfp451 A T 1: 33,802,167 probably benign Het
Zfp600 C T 4: 146,195,322 Q187* probably null Het
Other mutations in Ctbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02143:Ctbp2 APN 7 132991156 missense probably damaging 0.98
IGL02615:Ctbp2 APN 7 132995347 missense probably benign 0.34
IGL02626:Ctbp2 APN 7 132999211 missense probably benign 0.12
PIT4802001:Ctbp2 UTSW 7 132988245 missense possibly damaging 0.77
R0068:Ctbp2 UTSW 7 132990059 missense possibly damaging 0.95
R0374:Ctbp2 UTSW 7 132999344 missense possibly damaging 0.89
R0566:Ctbp2 UTSW 7 132991147 missense probably damaging 1.00
R0571:Ctbp2 UTSW 7 133014805 missense probably damaging 1.00
R1247:Ctbp2 UTSW 7 132995189 missense probably benign 0.24
R1292:Ctbp2 UTSW 7 133015189 missense probably damaging 1.00
R1477:Ctbp2 UTSW 7 132998941 missense probably damaging 1.00
R1732:Ctbp2 UTSW 7 132998924 missense possibly damaging 0.80
R1807:Ctbp2 UTSW 7 133014408 missense probably benign 0.00
R1865:Ctbp2 UTSW 7 132990554 missense probably benign 0.02
R1951:Ctbp2 UTSW 7 133015027 missense probably benign
R2393:Ctbp2 UTSW 7 133023561 critical splice donor site probably null
R2410:Ctbp2 UTSW 7 133014354 missense probably benign 0.08
R3427:Ctbp2 UTSW 7 132991592 missense probably damaging 1.00
R4004:Ctbp2 UTSW 7 132991773 missense probably benign 0.31
R4243:Ctbp2 UTSW 7 132998854 missense probably benign 0.43
R4754:Ctbp2 UTSW 7 133023558 splice site probably null
R4820:Ctbp2 UTSW 7 133013694 missense probably damaging 0.98
R4947:Ctbp2 UTSW 7 132999283 missense probably damaging 1.00
R4960:Ctbp2 UTSW 7 133014238 missense probably benign 0.00
R4999:Ctbp2 UTSW 7 133014649 missense possibly damaging 0.62
R5340:Ctbp2 UTSW 7 133013963 missense probably benign 0.43
R5593:Ctbp2 UTSW 7 132998869 missense possibly damaging 0.95
R5762:Ctbp2 UTSW 7 132995359 missense probably damaging 1.00
R6913:Ctbp2 UTSW 7 133014726 missense possibly damaging 0.94
R7342:Ctbp2 UTSW 7 133014312 missense probably damaging 0.99
R7358:Ctbp2 UTSW 7 132998881 missense probably damaging 1.00
R7376:Ctbp2 UTSW 7 133013968 missense possibly damaging 0.93
R7393:Ctbp2 UTSW 7 132988292 missense probably benign 0.17
R7678:Ctbp2 UTSW 7 133014624 missense probably benign
R7709:Ctbp2 UTSW 7 132990060 missense probably benign
R7900:Ctbp2 UTSW 7 133014599 missense probably benign
R8018:Ctbp2 UTSW 7 133014366 missense probably benign 0.38
Z1176:Ctbp2 UTSW 7 133015290 intron probably benign
Predicted Primers PCR Primer
(F):5'- TAGTAGTCTTGTGGCAGCACG -3'
(R):5'- CGTGCCTTGAAACAGAAACC -3'

Sequencing Primer
(F):5'- GAGCCACGGCCAGACATC -3'
(R):5'- CAGAAACCCCCAGTTGTTTG -3'
Posted On2019-05-13