Incidental Mutation 'R7044:Vegfc'
ID547214
Institutional Source Beutler Lab
Gene Symbol Vegfc
Ensembl Gene ENSMUSG00000031520
Gene Namevascular endothelial growth factor C
SynonymsVEGF-C
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7044 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location54077606-54187096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54157045 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 79 (K79E)
Ref Sequence ENSEMBL: ENSMUSP00000148210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033919] [ENSMUST00000210831]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033919
AA Change: K79E

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033919
Gene: ENSMUSG00000031520
AA Change: K79E

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
PDGF 125 209 5.07e-48 SMART
Pfam:CXCXC 279 291 1.6e-7 PFAM
Pfam:CXCXC 327 339 1.5e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000210831
AA Change: K79E

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.1070 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the platelet-derived growth factor/vascular endothelial growth factor (PDGF/VEGF) family. The encoded protein promotes angiogenesis and endothelial cell growth, and can also affect the permeability of blood vessels. The proprotein is further cleaved into a fully processed form that can bind and activate VEGFR-2 and VEGFR-3 receptors. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mutation of this gene affects the development of the lymphatic system. Homozygous inactivation is embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,612,280 D1169N possibly damaging Het
Ankrd6 T A 4: 32,815,260 Q448L possibly damaging Het
Appl1 A G 14: 26,928,677 S513P possibly damaging Het
Cdhr2 A T 13: 54,733,321 K1066* probably null Het
Ckap5 T C 2: 91,577,601 I824T probably benign Het
Ctbp2 T C 7: 133,015,102 R35G possibly damaging Het
Dcdc2c T C 12: 28,470,494 probably benign Het
Eya1 T A 1: 14,231,410 probably null Het
Fam105a A G 15: 27,657,235 probably benign Het
Fam207a T C 10: 77,514,392 D35G possibly damaging Het
Fat4 G C 3: 39,010,810 A4972P probably benign Het
Fat4 C T 3: 39,010,811 A4972V probably benign Het
Fbxl8 T A 8: 105,267,015 M1K probably null Het
Glyat T C 19: 12,650,265 S75P probably benign Het
Gm3543 T A 14: 41,980,066 I154F probably damaging Het
Gm4565 T A 7: 22,583,370 M8L probably benign Het
Gpr179 T C 11: 97,349,790 Q269R probably benign Het
Hfe2 C A 3: 96,527,474 H176Q possibly damaging Het
Ikzf2 T C 1: 69,538,901 H483R possibly damaging Het
Il25 G A 14: 54,933,158 A63T probably benign Het
Krt27 T A 11: 99,346,814 N366I probably benign Het
Mfge8 A G 7: 79,142,520 V219A probably benign Het
Nrbp1 T C 5: 31,249,946 V373A probably damaging Het
Olfr1186 A G 2: 88,526,486 N301S probably benign Het
Pcdh20 A G 14: 88,469,171 I231T probably damaging Het
Pfkp A G 13: 6,581,567 W151R probably damaging Het
Pikfyve T C 1: 65,246,854 I1084T probably benign Het
Poteg T C 8: 27,449,895 C27R probably damaging Het
Ptprz1 G A 6: 23,044,346 V1266M probably damaging Het
Rpa1 T C 11: 75,312,802 D358G probably damaging Het
Snapc4 A G 2: 26,369,953 S495P probably damaging Het
Surf6 A G 2: 26,899,356 I123T probably damaging Het
Sybu A T 15: 44,677,695 S324T possibly damaging Het
Trim3 A T 7: 105,618,214 S319R probably damaging Het
Trmt11 A G 10: 30,590,934 F72L probably benign Het
Tsks C T 7: 44,943,792 R61W probably damaging Het
Ube2k T C 5: 65,581,429 V36A possibly damaging Het
Ube3a T C 7: 59,288,413 V688A probably damaging Het
Vmn1r77 G A 7: 12,041,834 R179Q probably benign Het
Vmn2r97 T A 17: 18,914,367 F16I probably benign Het
Zfp451 A T 1: 33,802,167 probably benign Het
Zfp600 C T 4: 146,195,322 Q187* probably null Het
Other mutations in Vegfc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00658:Vegfc APN 8 54156948 splice site probably benign
IGL02120:Vegfc APN 8 54181401 missense possibly damaging 0.96
IGL03344:Vegfc APN 8 54157151 missense possibly damaging 0.64
R0620:Vegfc UTSW 8 54157139 missense probably benign 0.01
R1167:Vegfc UTSW 8 54186043 missense probably benign 0.06
R1826:Vegfc UTSW 8 54181312 missense possibly damaging 0.88
R4151:Vegfc UTSW 8 54077789 missense unknown
R4226:Vegfc UTSW 8 54159410 missense probably damaging 1.00
R4227:Vegfc UTSW 8 54159410 missense probably damaging 1.00
R4414:Vegfc UTSW 8 54181095 missense probably benign 0.02
R5963:Vegfc UTSW 8 54181284 missense probably benign
R6241:Vegfc UTSW 8 54181254 missense probably benign 0.00
R6368:Vegfc UTSW 8 54181230 missense probably damaging 1.00
R6728:Vegfc UTSW 8 54186022 missense probably damaging 0.99
R7776:Vegfc UTSW 8 54077800 missense unknown
Predicted Primers PCR Primer
(F):5'- GCAGATACAATGTCAGTCACATC -3'
(R):5'- TTCACACGGCATAGTCACTG -3'

Sequencing Primer
(F):5'- TGTCAGTCACATCAAACCAAAAAGG -3'
(R):5'- GTGTACAAGGTTCTGTTTGCCCAC -3'
Posted On2019-05-13