Incidental Mutation 'R7044:Trmt11'
ID 547216
Institutional Source Beutler Lab
Gene Symbol Trmt11
Ensembl Gene ENSMUSG00000019792
Gene Name tRNA methyltransferase 11
Synonyms 3110045I18Rik, 2410075D05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.867) question?
Stock # R7044 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 30534225-30600749 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30590934 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 72 (F72L)
Ref Sequence ENSEMBL: ENSMUSP00000149782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019927] [ENSMUST00000215595] [ENSMUST00000216790]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000019927
AA Change: V99A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019927
Gene: ENSMUSG00000019792
AA Change: V99A

DomainStartEndE-ValueType
Pfam:UPF0020 189 324 1.9e-14 PFAM
Pfam:Methyltransf_26 216 373 1.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215041
Predicted Effect probably benign
Transcript: ENSMUST00000215595
AA Change: F72L

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000216705
Predicted Effect probably benign
Transcript: ENSMUST00000216790
AA Change: F72L

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,612,280 D1169N possibly damaging Het
Ankrd6 T A 4: 32,815,260 Q448L possibly damaging Het
Appl1 A G 14: 26,928,677 S513P possibly damaging Het
Cdhr2 A T 13: 54,733,321 K1066* probably null Het
Ckap5 T C 2: 91,577,601 I824T probably benign Het
Ctbp2 T C 7: 133,015,102 R35G possibly damaging Het
Dcdc2c T C 12: 28,470,494 probably benign Het
Eya1 T A 1: 14,231,410 probably null Het
Fam105a A G 15: 27,657,235 probably benign Het
Fam207a T C 10: 77,514,392 D35G possibly damaging Het
Fat4 G C 3: 39,010,810 A4972P probably benign Het
Fat4 C T 3: 39,010,811 A4972V probably benign Het
Fbxl8 T A 8: 105,267,015 M1K probably null Het
Glyat T C 19: 12,650,265 S75P probably benign Het
Gm3543 T A 14: 41,980,066 I154F probably damaging Het
Gm4565 T A 7: 22,583,370 M8L probably benign Het
Gpr179 T C 11: 97,349,790 Q269R probably benign Het
Hfe2 C A 3: 96,527,474 H176Q possibly damaging Het
Ikzf2 T C 1: 69,538,901 H483R possibly damaging Het
Il25 G A 14: 54,933,158 A63T probably benign Het
Krt27 T A 11: 99,346,814 N366I probably benign Het
Mfge8 A G 7: 79,142,520 V219A probably benign Het
Nrbp1 T C 5: 31,249,946 V373A probably damaging Het
Olfr1186 A G 2: 88,526,486 N301S probably benign Het
Pcdh20 A G 14: 88,469,171 I231T probably damaging Het
Pfkp A G 13: 6,581,567 W151R probably damaging Het
Pikfyve T C 1: 65,246,854 I1084T probably benign Het
Poteg T C 8: 27,449,895 C27R probably damaging Het
Ptprz1 G A 6: 23,044,346 V1266M probably damaging Het
Rpa1 T C 11: 75,312,802 D358G probably damaging Het
Snapc4 A G 2: 26,369,953 S495P probably damaging Het
Surf6 A G 2: 26,899,356 I123T probably damaging Het
Sybu A T 15: 44,677,695 S324T possibly damaging Het
Trim3 A T 7: 105,618,214 S319R probably damaging Het
Tsks C T 7: 44,943,792 R61W probably damaging Het
Ube2k T C 5: 65,581,429 V36A possibly damaging Het
Ube3a T C 7: 59,288,413 V688A probably damaging Het
Vegfc A G 8: 54,157,045 K79E possibly damaging Het
Vmn1r77 G A 7: 12,041,834 R179Q probably benign Het
Vmn2r97 T A 17: 18,914,367 F16I probably benign Het
Zfp451 A T 1: 33,802,167 probably benign Het
Zfp600 C T 4: 146,195,322 Q187* probably null Het
Other mutations in Trmt11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Trmt11 APN 10 30566449 missense probably damaging 1.00
IGL01586:Trmt11 APN 10 30597751 missense probably benign 0.01
IGL02307:Trmt11 APN 10 30594154 missense possibly damaging 0.92
IGL02319:Trmt11 APN 10 30560873 missense probably damaging 1.00
IGL02622:Trmt11 APN 10 30559173 missense probably benign 0.00
R0047:Trmt11 UTSW 10 30535243 missense probably benign
R0047:Trmt11 UTSW 10 30535243 missense probably benign
R0269:Trmt11 UTSW 10 30587489 missense probably benign 0.01
R1240:Trmt11 UTSW 10 30590825 intron probably benign
R1694:Trmt11 UTSW 10 30535225 missense probably benign 0.02
R1765:Trmt11 UTSW 10 30559188 missense probably benign
R2293:Trmt11 UTSW 10 30547748 missense probably damaging 0.98
R2295:Trmt11 UTSW 10 30547748 missense probably damaging 0.98
R2857:Trmt11 UTSW 10 30547748 missense probably damaging 0.98
R4631:Trmt11 UTSW 10 30559204 missense probably benign 0.00
R5684:Trmt11 UTSW 10 30547710 missense probably damaging 1.00
R5952:Trmt11 UTSW 10 30560842 missense probably benign 0.01
R6022:Trmt11 UTSW 10 30587501 missense possibly damaging 0.76
R7459:Trmt11 UTSW 10 30590043 missense probably benign 0.02
R7538:Trmt11 UTSW 10 30560874 missense probably damaging 1.00
R7672:Trmt11 UTSW 10 30587524 missense probably damaging 1.00
R7728:Trmt11 UTSW 10 30587501 missense possibly damaging 0.76
R8116:Trmt11 UTSW 10 30566494 missense possibly damaging 0.88
R8988:Trmt11 UTSW 10 30591031 missense probably benign
R9225:Trmt11 UTSW 10 30547757 missense probably damaging 1.00
R9507:Trmt11 UTSW 10 30558942 nonsense probably null
R9555:Trmt11 UTSW 10 30594154 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGCTAGGGTGCACTGACTAC -3'
(R):5'- GCTGTCTGAACTAAGTTCTTTACTGAG -3'

Sequencing Primer
(F):5'- TGACTACAGGCTCTGGGTCAG -3'
(R):5'- AGTTCTTTACTGAGGTTAGTACCAC -3'
Posted On 2019-05-13