Incidental Mutation 'R7044:Trmt11'
ID547216
Institutional Source Beutler Lab
Gene Symbol Trmt11
Ensembl Gene ENSMUSG00000019792
Gene NametRNA methyltransferase 11
Synonyms3110045I18Rik, 2410075D05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.852) question?
Stock #R7044 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location30534225-30600749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30590934 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 72 (F72L)
Ref Sequence ENSEMBL: ENSMUSP00000149782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019927] [ENSMUST00000215595] [ENSMUST00000216790]
Predicted Effect probably benign
Transcript: ENSMUST00000019927
AA Change: V99A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019927
Gene: ENSMUSG00000019792
AA Change: V99A

DomainStartEndE-ValueType
Pfam:UPF0020 189 324 1.9e-14 PFAM
Pfam:Methyltransf_26 216 373 1.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215041
Predicted Effect probably benign
Transcript: ENSMUST00000215595
AA Change: F72L

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000216705
Predicted Effect probably benign
Transcript: ENSMUST00000216790
AA Change: F72L

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,612,280 D1169N possibly damaging Het
Ankrd6 T A 4: 32,815,260 Q448L possibly damaging Het
Appl1 A G 14: 26,928,677 S513P possibly damaging Het
Cdhr2 A T 13: 54,733,321 K1066* probably null Het
Ckap5 T C 2: 91,577,601 I824T probably benign Het
Ctbp2 T C 7: 133,015,102 R35G possibly damaging Het
Dcdc2c T C 12: 28,470,494 probably benign Het
Eya1 T A 1: 14,231,410 probably null Het
Fam105a A G 15: 27,657,235 probably benign Het
Fam207a T C 10: 77,514,392 D35G possibly damaging Het
Fat4 G C 3: 39,010,810 A4972P probably benign Het
Fat4 C T 3: 39,010,811 A4972V probably benign Het
Fbxl8 T A 8: 105,267,015 M1K probably null Het
Glyat T C 19: 12,650,265 S75P probably benign Het
Gm3543 T A 14: 41,980,066 I154F probably damaging Het
Gm4565 T A 7: 22,583,370 M8L probably benign Het
Gpr179 T C 11: 97,349,790 Q269R probably benign Het
Hfe2 C A 3: 96,527,474 H176Q possibly damaging Het
Ikzf2 T C 1: 69,538,901 H483R possibly damaging Het
Il25 G A 14: 54,933,158 A63T probably benign Het
Krt27 T A 11: 99,346,814 N366I probably benign Het
Mfge8 A G 7: 79,142,520 V219A probably benign Het
Nrbp1 T C 5: 31,249,946 V373A probably damaging Het
Olfr1186 A G 2: 88,526,486 N301S probably benign Het
Pcdh20 A G 14: 88,469,171 I231T probably damaging Het
Pfkp A G 13: 6,581,567 W151R probably damaging Het
Pikfyve T C 1: 65,246,854 I1084T probably benign Het
Poteg T C 8: 27,449,895 C27R probably damaging Het
Ptprz1 G A 6: 23,044,346 V1266M probably damaging Het
Rpa1 T C 11: 75,312,802 D358G probably damaging Het
Snapc4 A G 2: 26,369,953 S495P probably damaging Het
Surf6 A G 2: 26,899,356 I123T probably damaging Het
Sybu A T 15: 44,677,695 S324T possibly damaging Het
Trim3 A T 7: 105,618,214 S319R probably damaging Het
Tsks C T 7: 44,943,792 R61W probably damaging Het
Ube2k T C 5: 65,581,429 V36A possibly damaging Het
Ube3a T C 7: 59,288,413 V688A probably damaging Het
Vegfc A G 8: 54,157,045 K79E possibly damaging Het
Vmn1r77 G A 7: 12,041,834 R179Q probably benign Het
Vmn2r97 T A 17: 18,914,367 F16I probably benign Het
Zfp451 A T 1: 33,802,167 probably benign Het
Zfp600 C T 4: 146,195,322 Q187* probably null Het
Other mutations in Trmt11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Trmt11 APN 10 30566449 missense probably damaging 1.00
IGL01586:Trmt11 APN 10 30597751 missense probably benign 0.01
IGL02307:Trmt11 APN 10 30594154 missense possibly damaging 0.92
IGL02319:Trmt11 APN 10 30560873 missense probably damaging 1.00
IGL02622:Trmt11 APN 10 30559173 missense probably benign 0.00
R0047:Trmt11 UTSW 10 30535243 missense probably benign
R0047:Trmt11 UTSW 10 30535243 missense probably benign
R0269:Trmt11 UTSW 10 30587489 missense probably benign 0.01
R1240:Trmt11 UTSW 10 30590825 intron probably benign
R1694:Trmt11 UTSW 10 30535225 missense probably benign 0.02
R1765:Trmt11 UTSW 10 30559188 missense probably benign
R2293:Trmt11 UTSW 10 30547748 missense probably damaging 0.98
R2295:Trmt11 UTSW 10 30547748 missense probably damaging 0.98
R2857:Trmt11 UTSW 10 30547748 missense probably damaging 0.98
R4631:Trmt11 UTSW 10 30559204 missense probably benign 0.00
R5684:Trmt11 UTSW 10 30547710 missense probably damaging 1.00
R5952:Trmt11 UTSW 10 30560842 missense probably benign 0.01
R6022:Trmt11 UTSW 10 30587501 missense possibly damaging 0.76
R7459:Trmt11 UTSW 10 30590043 missense probably benign 0.02
R7538:Trmt11 UTSW 10 30560874 missense probably damaging 1.00
R7672:Trmt11 UTSW 10 30587524 missense probably damaging 1.00
R7728:Trmt11 UTSW 10 30587501 missense possibly damaging 0.76
R8116:Trmt11 UTSW 10 30566494 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGCTAGGGTGCACTGACTAC -3'
(R):5'- GCTGTCTGAACTAAGTTCTTTACTGAG -3'

Sequencing Primer
(F):5'- TGACTACAGGCTCTGGGTCAG -3'
(R):5'- AGTTCTTTACTGAGGTTAGTACCAC -3'
Posted On2019-05-13