Incidental Mutation 'R7044:Krt27'
ID547220
Institutional Source Beutler Lab
Gene Symbol Krt27
Ensembl Gene ENSMUSG00000017588
Gene Namekeratin 27
SynonymsmIRSa3.1, Krt1-c29
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R7044 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location99345565-99351104 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99346814 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 366 (N366I)
Ref Sequence ENSEMBL: ENSMUSP00000017732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017732]
Predicted Effect probably benign
Transcript: ENSMUST00000017732
AA Change: N366I

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000017732
Gene: ENSMUSG00000017588
AA Change: N366I

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
low complexity region 36 61 N/A INTRINSIC
Filament 73 388 6.3e-151 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The mouse type I keratin genes are clustered in a region of chromosome 11. The encoded protein is involved in the formation of intermediate filaments in the inner root sheath. [provided by RefSeq, Sep 2015]
PHENOTYPE: Newborn heterozygotes show a slight bending of the whiskers. At ~P12, the coat develops a loose wave pattern. Whiskers of homozygotes are more curly and irregular while coat waviness occurs earlier and is more prominent. Adult coats are not waved but remains rough in texture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,612,280 D1169N possibly damaging Het
Ankrd6 T A 4: 32,815,260 Q448L possibly damaging Het
Appl1 A G 14: 26,928,677 S513P possibly damaging Het
Cdhr2 A T 13: 54,733,321 K1066* probably null Het
Ckap5 T C 2: 91,577,601 I824T probably benign Het
Ctbp2 T C 7: 133,015,102 R35G possibly damaging Het
Dcdc2c T C 12: 28,470,494 probably benign Het
Eya1 T A 1: 14,231,410 probably null Het
Fam105a A G 15: 27,657,235 probably benign Het
Fam207a T C 10: 77,514,392 D35G possibly damaging Het
Fat4 G C 3: 39,010,810 A4972P probably benign Het
Fat4 C T 3: 39,010,811 A4972V probably benign Het
Fbxl8 T A 8: 105,267,015 M1K probably null Het
Glyat T C 19: 12,650,265 S75P probably benign Het
Gm3543 T A 14: 41,980,066 I154F probably damaging Het
Gm4565 T A 7: 22,583,370 M8L probably benign Het
Gpr179 T C 11: 97,349,790 Q269R probably benign Het
Hfe2 C A 3: 96,527,474 H176Q possibly damaging Het
Ikzf2 T C 1: 69,538,901 H483R possibly damaging Het
Il25 G A 14: 54,933,158 A63T probably benign Het
Mfge8 A G 7: 79,142,520 V219A probably benign Het
Nrbp1 T C 5: 31,249,946 V373A probably damaging Het
Olfr1186 A G 2: 88,526,486 N301S probably benign Het
Pcdh20 A G 14: 88,469,171 I231T probably damaging Het
Pfkp A G 13: 6,581,567 W151R probably damaging Het
Pikfyve T C 1: 65,246,854 I1084T probably benign Het
Poteg T C 8: 27,449,895 C27R probably damaging Het
Ptprz1 G A 6: 23,044,346 V1266M probably damaging Het
Rpa1 T C 11: 75,312,802 D358G probably damaging Het
Snapc4 A G 2: 26,369,953 S495P probably damaging Het
Surf6 A G 2: 26,899,356 I123T probably damaging Het
Sybu A T 15: 44,677,695 S324T possibly damaging Het
Trim3 A T 7: 105,618,214 S319R probably damaging Het
Trmt11 A G 10: 30,590,934 F72L probably benign Het
Tsks C T 7: 44,943,792 R61W probably damaging Het
Ube2k T C 5: 65,581,429 V36A possibly damaging Het
Ube3a T C 7: 59,288,413 V688A probably damaging Het
Vegfc A G 8: 54,157,045 K79E possibly damaging Het
Vmn1r77 G A 7: 12,041,834 R179Q probably benign Het
Vmn2r97 T A 17: 18,914,367 F16I probably benign Het
Zfp451 A T 1: 33,802,167 probably benign Het
Zfp600 C T 4: 146,195,322 Q187* probably null Het
Other mutations in Krt27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01970:Krt27 APN 11 99348721 missense probably damaging 0.98
R1957:Krt27 UTSW 11 99346483 critical splice donor site probably null
R2014:Krt27 UTSW 11 99349492 missense probably benign 0.09
R4095:Krt27 UTSW 11 99345793 missense probably benign 0.00
R4768:Krt27 UTSW 11 99349525 missense probably damaging 1.00
R4975:Krt27 UTSW 11 99346896 nonsense probably null
R5236:Krt27 UTSW 11 99350815 missense possibly damaging 0.87
R6750:Krt27 UTSW 11 99348980 missense probably damaging 0.96
R7658:Krt27 UTSW 11 99349486 missense possibly damaging 0.69
R8308:Krt27 UTSW 11 99349036 missense probably benign 0.39
Z1176:Krt27 UTSW 11 99348978 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGCTGAAGTAACACTGGGG -3'
(R):5'- GGCTTGGCTTATTCTGAATCAGTAC -3'

Sequencing Primer
(F):5'- CTGGGGAGAGAGGTTCCATTCAC -3'
(R):5'- GCTTATTCTGAATCAGTACAGTAACG -3'
Posted On2019-05-13