Incidental Mutation 'R7044:Gm3543'
ID 547225
Institutional Source Beutler Lab
Gene Symbol Gm3543
Ensembl Gene ENSMUSG00000093945
Gene Name predicted gene 3543
Synonyms
MMRRC Submission 045143-MU
Accession Numbers
Essential gene? Not available question?
Stock # R7044 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 41799830-41805282 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 41802023 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 154 (I154F)
Ref Sequence ENSEMBL: ENSMUSP00000107501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064162] [ENSMUST00000111870] [ENSMUST00000168972] [ENSMUST00000179947]
AlphaFold D3Z235
Predicted Effect probably benign
Transcript: ENSMUST00000064162
SMART Domains Protein: ENSMUSP00000064211
Gene: ENSMUSG00000052334

DomainStartEndE-ValueType
Pfam:Takusan 10 93 3.7e-35 PFAM
coiled coil region 108 141 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111870
AA Change: I154F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107501
Gene: ENSMUSG00000093945
AA Change: I154F

DomainStartEndE-ValueType
Pfam:Takusan 8 89 4.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168972
SMART Domains Protein: ENSMUSP00000127922
Gene: ENSMUSG00000052334

DomainStartEndE-ValueType
Pfam:Takusan 10 93 8.6e-36 PFAM
coiled coil region 108 141 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179947
SMART Domains Protein: ENSMUSP00000136563
Gene: ENSMUSG00000093945

DomainStartEndE-ValueType
Pfam:Takusan 1 33 6.7e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd6 T A 4: 32,815,260 (GRCm39) Q448L possibly damaging Het
Appl1 A G 14: 26,650,634 (GRCm39) S513P possibly damaging Het
Cdhr2 A T 13: 54,881,134 (GRCm39) K1066* probably null Het
Ckap5 T C 2: 91,407,946 (GRCm39) I824T probably benign Het
Cracdl C T 1: 37,651,361 (GRCm39) D1169N possibly damaging Het
Ctbp2 T C 7: 132,616,831 (GRCm39) R35G possibly damaging Het
Dcdc2c T C 12: 28,520,493 (GRCm39) probably benign Het
Eya1 T A 1: 14,301,634 (GRCm39) probably null Het
Fat4 G C 3: 39,064,959 (GRCm39) A4972P probably benign Het
Fat4 C T 3: 39,064,960 (GRCm39) A4972V probably benign Het
Fbxl8 T A 8: 105,993,647 (GRCm39) M1K probably null Het
Glyat T C 19: 12,627,629 (GRCm39) S75P probably benign Het
Gm4565 T A 7: 22,282,795 (GRCm39) M8L probably benign Het
Gpr179 T C 11: 97,240,616 (GRCm39) Q269R probably benign Het
Hjv C A 3: 96,434,790 (GRCm39) H176Q possibly damaging Het
Ikzf2 T C 1: 69,578,060 (GRCm39) H483R possibly damaging Het
Il25 G A 14: 55,170,615 (GRCm39) A63T probably benign Het
Krt27 T A 11: 99,237,640 (GRCm39) N366I probably benign Het
Mfge8 A G 7: 78,792,268 (GRCm39) V219A probably benign Het
Nrbp1 T C 5: 31,407,290 (GRCm39) V373A probably damaging Het
Or4c100 A G 2: 88,356,830 (GRCm39) N301S probably benign Het
Otulinl A G 15: 27,657,321 (GRCm39) probably benign Het
Pcdh20 A G 14: 88,706,607 (GRCm39) I231T probably damaging Het
Pfkp A G 13: 6,631,603 (GRCm39) W151R probably damaging Het
Pikfyve T C 1: 65,286,013 (GRCm39) I1084T probably benign Het
Poteg T C 8: 27,939,923 (GRCm39) C27R probably damaging Het
Ptprz1 G A 6: 23,044,345 (GRCm39) V1266M probably damaging Het
Rpa1 T C 11: 75,203,628 (GRCm39) D358G probably damaging Het
Slx9 T C 10: 77,350,226 (GRCm39) D35G possibly damaging Het
Snapc4 A G 2: 26,259,965 (GRCm39) S495P probably damaging Het
Surf6 A G 2: 26,789,368 (GRCm39) I123T probably damaging Het
Sybu A T 15: 44,541,091 (GRCm39) S324T possibly damaging Het
Trim3 A T 7: 105,267,421 (GRCm39) S319R probably damaging Het
Trmt11 A G 10: 30,466,930 (GRCm39) F72L probably benign Het
Tsks C T 7: 44,593,216 (GRCm39) R61W probably damaging Het
Ube2k T C 5: 65,738,772 (GRCm39) V36A possibly damaging Het
Ube3a T C 7: 58,938,161 (GRCm39) V688A probably damaging Het
Vegfc A G 8: 54,610,080 (GRCm39) K79E possibly damaging Het
Vmn1r77 G A 7: 11,775,761 (GRCm39) R179Q probably benign Het
Vmn2r97 T A 17: 19,134,629 (GRCm39) F16I probably benign Het
Zfp451 A T 1: 33,841,248 (GRCm39) probably benign Het
Zfp600 C T 4: 146,131,892 (GRCm39) Q187* probably null Het
Other mutations in Gm3543
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02553:Gm3543 APN 14 41,802,048 (GRCm39) missense probably benign 0.08
IGL03067:Gm3543 APN 14 41,802,830 (GRCm39) splice site probably benign
IGL03162:Gm3543 APN 14 41,802,022 (GRCm39) missense possibly damaging 0.84
R7975:Gm3543 UTSW 14 41,802,122 (GRCm39) missense probably benign 0.00
R9274:Gm3543 UTSW 14 41,802,125 (GRCm39) missense probably damaging 0.99
R9365:Gm3543 UTSW 14 41,804,093 (GRCm39) missense possibly damaging 0.77
Z1176:Gm3543 UTSW 14 41,802,964 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAACTCCAGAGAAAGTCTTGG -3'
(R):5'- AATCTGGATACTTATCTGGGGC -3'

Sequencing Primer
(F):5'- CAACTCCAGAGAAAGTCTTGGTAATG -3'
(R):5'- ATGGATGCTGCCTGGAGTCAC -3'
Posted On 2019-05-13