Incidental Mutation 'R7044:Il25'
ID547226
Institutional Source Beutler Lab
Gene Symbol Il25
Ensembl Gene ENSMUSG00000040770
Gene Nameinterleukin 25
SynonymsIl17e, IL-17E
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7044 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location54932695-54935837 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 54933158 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 63 (A63T)
Ref Sequence ENSEMBL: ENSMUSP00000039641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037814] [ENSMUST00000037863] [ENSMUST00000227441]
Predicted Effect probably benign
Transcript: ENSMUST00000037814
SMART Domains Protein: ENSMUSP00000036138
Gene: ENSMUSG00000040759

DomainStartEndE-ValueType
transmembrane domain 35 56 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
transmembrane domain 95 114 N/A INTRINSIC
transmembrane domain 119 136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037863
AA Change: A63T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039641
Gene: ENSMUSG00000040770
AA Change: A63T

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:IL17 77 163 4.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227441
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that shares sequence similarity with interleukin 17. This cytokine can induce NF-kappaB activation, and stimulate the production of interleukin 8. Both this cytokine and interleukin 17B are ligands for the cytokine receptor IL17BR. Studies of a similar gene in mice suggest that this cytokine may be a pro-inflammatory cytokine favoring the Th2-type immune response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele have increased susceptibility to parasitic infection. Male homozygous mutant mice exhibit notably increased mean serum triglyceride levels in another null allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,612,280 D1169N possibly damaging Het
Ankrd6 T A 4: 32,815,260 Q448L possibly damaging Het
Appl1 A G 14: 26,928,677 S513P possibly damaging Het
Cdhr2 A T 13: 54,733,321 K1066* probably null Het
Ckap5 T C 2: 91,577,601 I824T probably benign Het
Ctbp2 T C 7: 133,015,102 R35G possibly damaging Het
Dcdc2c T C 12: 28,470,494 probably benign Het
Eya1 T A 1: 14,231,410 probably null Het
Fam105a A G 15: 27,657,235 probably benign Het
Fam207a T C 10: 77,514,392 D35G possibly damaging Het
Fat4 G C 3: 39,010,810 A4972P probably benign Het
Fat4 C T 3: 39,010,811 A4972V probably benign Het
Fbxl8 T A 8: 105,267,015 M1K probably null Het
Glyat T C 19: 12,650,265 S75P probably benign Het
Gm3543 T A 14: 41,980,066 I154F probably damaging Het
Gm4565 T A 7: 22,583,370 M8L probably benign Het
Gpr179 T C 11: 97,349,790 Q269R probably benign Het
Hfe2 C A 3: 96,527,474 H176Q possibly damaging Het
Ikzf2 T C 1: 69,538,901 H483R possibly damaging Het
Krt27 T A 11: 99,346,814 N366I probably benign Het
Mfge8 A G 7: 79,142,520 V219A probably benign Het
Nrbp1 T C 5: 31,249,946 V373A probably damaging Het
Olfr1186 A G 2: 88,526,486 N301S probably benign Het
Pcdh20 A G 14: 88,469,171 I231T probably damaging Het
Pfkp A G 13: 6,581,567 W151R probably damaging Het
Pikfyve T C 1: 65,246,854 I1084T probably benign Het
Poteg T C 8: 27,449,895 C27R probably damaging Het
Ptprz1 G A 6: 23,044,346 V1266M probably damaging Het
Rpa1 T C 11: 75,312,802 D358G probably damaging Het
Snapc4 A G 2: 26,369,953 S495P probably damaging Het
Surf6 A G 2: 26,899,356 I123T probably damaging Het
Sybu A T 15: 44,677,695 S324T possibly damaging Het
Trim3 A T 7: 105,618,214 S319R probably damaging Het
Trmt11 A G 10: 30,590,934 F72L probably benign Het
Tsks C T 7: 44,943,792 R61W probably damaging Het
Ube2k T C 5: 65,581,429 V36A possibly damaging Het
Ube3a T C 7: 59,288,413 V688A probably damaging Het
Vegfc A G 8: 54,157,045 K79E possibly damaging Het
Vmn1r77 G A 7: 12,041,834 R179Q probably benign Het
Vmn2r97 T A 17: 18,914,367 F16I probably benign Het
Zfp451 A T 1: 33,802,167 probably benign Het
Zfp600 C T 4: 146,195,322 Q187* probably null Het
Other mutations in Il25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03327:Il25 APN 14 54935360 unclassified probably benign
R0035:Il25 UTSW 14 54933096 missense probably damaging 0.99
R0368:Il25 UTSW 14 54935174 splice site probably null
R1212:Il25 UTSW 14 54932755 unclassified probably benign
R6733:Il25 UTSW 14 54933033 missense probably benign 0.07
R7464:Il25 UTSW 14 54933222 missense probably null 1.00
R7488:Il25 UTSW 14 54933002 missense probably benign
Z1177:Il25 UTSW 14 54935207 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAGGCTGTTGCATTCTTGGC -3'
(R):5'- CTGAGAGTCAAATTCAGGCCTG -3'

Sequencing Primer
(F):5'- CATTCTTGGCAATGATCGTGGGAAC -3'
(R):5'- CAAATTCAGGCCTGTGTAGC -3'
Posted On2019-05-13