Incidental Mutation 'R7044:Pcdh20'
ID 547227
Institutional Source Beutler Lab
Gene Symbol Pcdh20
Ensembl Gene ENSMUSG00000050505
Gene Name protocadherin 20
Synonyms C630015B17Rik, PCDH13
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7044 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 88464743-88471396 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 88469171 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 231 (I231T)
Ref Sequence ENSEMBL: ENSMUSP00000141860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061628] [ENSMUST00000192557]
AlphaFold Q8BIZ0
Predicted Effect probably damaging
Transcript: ENSMUST00000061628
AA Change: I231T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054774
Gene: ENSMUSG00000050505
AA Change: I231T

DomainStartEndE-ValueType
CA 108 208 9.02e-1 SMART
CA 233 319 6.63e-16 SMART
CA 343 425 9.94e-2 SMART
CA 455 534 7.48e-3 SMART
CA 558 638 5.46e-26 SMART
CA 662 741 7.2e-26 SMART
CA 768 852 9.6e-13 SMART
low complexity region 860 871 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192557
AA Change: I231T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141860
Gene: ENSMUSG00000050505
AA Change: I231T

DomainStartEndE-ValueType
CA 108 208 9.02e-1 SMART
CA 233 319 6.63e-16 SMART
CA 343 425 9.94e-2 SMART
CA 455 534 7.48e-3 SMART
CA 558 638 5.46e-26 SMART
CA 662 741 7.2e-26 SMART
CA 768 852 9.6e-13 SMART
low complexity region 860 871 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein contains six extracellular cadherin domains, a transmembrane domain, and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein may play a role in cell adhesion in the nervous system and has been shown to be specifically expressed in newly differentiated olfactory sensory neurons and their axons during development. In adult mice, the expression of this protein in the olfactory system is more restricted but shows a gender difference with higher expression in the male than in the female. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,612,280 D1169N possibly damaging Het
Ankrd6 T A 4: 32,815,260 Q448L possibly damaging Het
Appl1 A G 14: 26,928,677 S513P possibly damaging Het
Cdhr2 A T 13: 54,733,321 K1066* probably null Het
Ckap5 T C 2: 91,577,601 I824T probably benign Het
Ctbp2 T C 7: 133,015,102 R35G possibly damaging Het
Dcdc2c T C 12: 28,470,494 probably benign Het
Eya1 T A 1: 14,231,410 probably null Het
Fam105a A G 15: 27,657,235 probably benign Het
Fam207a T C 10: 77,514,392 D35G possibly damaging Het
Fat4 G C 3: 39,010,810 A4972P probably benign Het
Fat4 C T 3: 39,010,811 A4972V probably benign Het
Fbxl8 T A 8: 105,267,015 M1K probably null Het
Glyat T C 19: 12,650,265 S75P probably benign Het
Gm3543 T A 14: 41,980,066 I154F probably damaging Het
Gm4565 T A 7: 22,583,370 M8L probably benign Het
Gpr179 T C 11: 97,349,790 Q269R probably benign Het
Hfe2 C A 3: 96,527,474 H176Q possibly damaging Het
Ikzf2 T C 1: 69,538,901 H483R possibly damaging Het
Il25 G A 14: 54,933,158 A63T probably benign Het
Krt27 T A 11: 99,346,814 N366I probably benign Het
Mfge8 A G 7: 79,142,520 V219A probably benign Het
Nrbp1 T C 5: 31,249,946 V373A probably damaging Het
Olfr1186 A G 2: 88,526,486 N301S probably benign Het
Pfkp A G 13: 6,581,567 W151R probably damaging Het
Pikfyve T C 1: 65,246,854 I1084T probably benign Het
Poteg T C 8: 27,449,895 C27R probably damaging Het
Ptprz1 G A 6: 23,044,346 V1266M probably damaging Het
Rpa1 T C 11: 75,312,802 D358G probably damaging Het
Snapc4 A G 2: 26,369,953 S495P probably damaging Het
Surf6 A G 2: 26,899,356 I123T probably damaging Het
Sybu A T 15: 44,677,695 S324T possibly damaging Het
Trim3 A T 7: 105,618,214 S319R probably damaging Het
Trmt11 A G 10: 30,590,934 F72L probably benign Het
Tsks C T 7: 44,943,792 R61W probably damaging Het
Ube2k T C 5: 65,581,429 V36A possibly damaging Het
Ube3a T C 7: 59,288,413 V688A probably damaging Het
Vegfc A G 8: 54,157,045 K79E possibly damaging Het
Vmn1r77 G A 7: 12,041,834 R179Q probably benign Het
Vmn2r97 T A 17: 18,914,367 F16I probably benign Het
Zfp451 A T 1: 33,802,167 probably benign Het
Zfp600 C T 4: 146,195,322 Q187* probably null Het
Other mutations in Pcdh20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Pcdh20 APN 14 88467881 missense possibly damaging 0.65
IGL01112:Pcdh20 APN 14 88467200 missense probably benign 0.01
IGL01586:Pcdh20 APN 14 88470908 missense probably benign 0.37
IGL02007:Pcdh20 APN 14 88469595 missense probably benign 0.09
IGL02545:Pcdh20 APN 14 88468844 missense possibly damaging 0.74
IGL02935:Pcdh20 APN 14 88467002 utr 3 prime probably benign
PIT4362001:Pcdh20 UTSW 14 88467026 missense probably damaging 0.97
PIT4403001:Pcdh20 UTSW 14 88467026 missense probably damaging 0.97
PIT4453001:Pcdh20 UTSW 14 88467308 missense probably damaging 1.00
R0322:Pcdh20 UTSW 14 88468947 missense probably benign 0.24
R0372:Pcdh20 UTSW 14 88469003 missense probably damaging 1.00
R0391:Pcdh20 UTSW 14 88468668 missense probably benign
R0575:Pcdh20 UTSW 14 88467612 missense probably damaging 1.00
R0789:Pcdh20 UTSW 14 88468790 missense probably damaging 1.00
R1370:Pcdh20 UTSW 14 88468301 missense probably benign 0.00
R1465:Pcdh20 UTSW 14 88469237 missense probably benign 0.00
R1465:Pcdh20 UTSW 14 88469237 missense probably benign 0.00
R1664:Pcdh20 UTSW 14 88468322 missense possibly damaging 0.63
R1677:Pcdh20 UTSW 14 88467974 missense probably damaging 1.00
R1764:Pcdh20 UTSW 14 88469184 missense possibly damaging 0.77
R1907:Pcdh20 UTSW 14 88468704 missense probably benign 0.01
R2043:Pcdh20 UTSW 14 88467155 missense probably benign 0.01
R2430:Pcdh20 UTSW 14 88467548 missense probably damaging 1.00
R2471:Pcdh20 UTSW 14 88467236 missense probably benign 0.00
R3838:Pcdh20 UTSW 14 88468463 missense probably benign 0.00
R4163:Pcdh20 UTSW 14 88468179 missense probably damaging 1.00
R4472:Pcdh20 UTSW 14 88468998 missense probably benign 0.21
R4602:Pcdh20 UTSW 14 88468430 missense probably damaging 1.00
R4681:Pcdh20 UTSW 14 88467616 missense probably damaging 1.00
R4918:Pcdh20 UTSW 14 88467668 missense probably damaging 1.00
R4921:Pcdh20 UTSW 14 88469726 missense probably benign 0.01
R5204:Pcdh20 UTSW 14 88468915 missense probably damaging 1.00
R5256:Pcdh20 UTSW 14 88468377 missense probably benign
R5652:Pcdh20 UTSW 14 88467324 missense probably damaging 1.00
R5815:Pcdh20 UTSW 14 88470876 missense probably benign 0.03
R6195:Pcdh20 UTSW 14 88468052 missense probably benign 0.39
R6233:Pcdh20 UTSW 14 88468052 missense probably benign 0.39
R6848:Pcdh20 UTSW 14 88467254 missense probably benign 0.03
R6913:Pcdh20 UTSW 14 88468602 missense probably benign
R7224:Pcdh20 UTSW 14 88469075 missense possibly damaging 0.85
R7388:Pcdh20 UTSW 14 88468667 missense probably benign 0.33
R7486:Pcdh20 UTSW 14 88468614 missense possibly damaging 0.79
R7651:Pcdh20 UTSW 14 88469153 missense probably damaging 1.00
R7664:Pcdh20 UTSW 14 88469367 missense probably benign
R7706:Pcdh20 UTSW 14 88467357 missense probably damaging 1.00
R7832:Pcdh20 UTSW 14 88469707 missense probably null 0.02
R7892:Pcdh20 UTSW 14 88467431 nonsense probably null
R8218:Pcdh20 UTSW 14 88468611 missense probably damaging 0.96
R8545:Pcdh20 UTSW 14 88469165 missense probably damaging 0.96
R8701:Pcdh20 UTSW 14 88468413 missense possibly damaging 0.95
R9219:Pcdh20 UTSW 14 88468819 missense probably benign 0.01
R9238:Pcdh20 UTSW 14 88468754 missense probably benign 0.43
R9418:Pcdh20 UTSW 14 88468019 missense probably benign
X0028:Pcdh20 UTSW 14 88467617 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTCACATACTGGTCCTGGG -3'
(R):5'- AAGCATTGTGCCTGGATGGG -3'

Sequencing Primer
(F):5'- GGGTTTCTCTGTCCAAAGCAC -3'
(R):5'- CGGCAGTACCTCCATTGC -3'
Posted On 2019-05-13