Incidental Mutation 'R7044:Sybu'
ID547229
Institutional Source Beutler Lab
Gene Symbol Sybu
Ensembl Gene ENSMUSG00000022340
Gene Namesyntabulin (syntaxin-interacting)
SynonymsA830027B17Rik, Golsyn/Syntabulin, 5730410E15Rik
MMRRC Submission
Accession Numbers

Genbank: NM_176998 ; MGI: 2442392

Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R7044 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location44671856-44788063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44677695 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 324 (S324T)
Ref Sequence ENSEMBL: ENSMUSP00000087511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090057] [ENSMUST00000110267] [ENSMUST00000110269] [ENSMUST00000226214] [ENSMUST00000227305] [ENSMUST00000228057]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090057
AA Change: S324T

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087511
Gene: ENSMUSG00000022340
AA Change: S324T

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
low complexity region 112 120 N/A INTRINSIC
low complexity region 148 163 N/A INTRINSIC
low complexity region 174 205 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
Pfam:Syntaphilin 343 638 3.5e-142 PFAM
low complexity region 738 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110267
AA Change: S196T

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105896
Gene: ENSMUSG00000022340
AA Change: S196T

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
low complexity region 46 77 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
low complexity region 148 162 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
Pfam:Syntaphilin 214 511 5.8e-140 PFAM
low complexity region 610 627 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110269
AA Change: S124T

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105898
Gene: ENSMUSG00000022340
AA Change: S124T

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
low complexity region 120 131 N/A INTRINSIC
Pfam:Syntaphilin 142 439 4.4e-140 PFAM
low complexity region 538 555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226214
Predicted Effect possibly damaging
Transcript: ENSMUST00000227305
AA Change: S195T

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000228057
AA Change: S196T

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntabulin/GOLSYN is part of a kinesin motor-adaptor complex that is critical for the anterograde axonal transport of active zone components and contributes to activity-dependent presynaptic assembly during neuronal development (Cai et al., 2007 [PubMed 17611281]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,612,280 D1169N possibly damaging Het
Ankrd6 T A 4: 32,815,260 Q448L possibly damaging Het
Appl1 A G 14: 26,928,677 S513P possibly damaging Het
Cdhr2 A T 13: 54,733,321 K1066* probably null Het
Ckap5 T C 2: 91,577,601 I824T probably benign Het
Ctbp2 T C 7: 133,015,102 R35G possibly damaging Het
Dcdc2c T C 12: 28,470,494 probably benign Het
Eya1 T A 1: 14,231,410 probably null Het
Fam105a A G 15: 27,657,235 probably benign Het
Fam207a T C 10: 77,514,392 D35G possibly damaging Het
Fat4 G C 3: 39,010,810 A4972P probably benign Het
Fat4 C T 3: 39,010,811 A4972V probably benign Het
Fbxl8 T A 8: 105,267,015 M1K probably null Het
Glyat T C 19: 12,650,265 S75P probably benign Het
Gm3543 T A 14: 41,980,066 I154F probably damaging Het
Gm4565 T A 7: 22,583,370 M8L probably benign Het
Gpr179 T C 11: 97,349,790 Q269R probably benign Het
Hfe2 C A 3: 96,527,474 H176Q possibly damaging Het
Ikzf2 T C 1: 69,538,901 H483R possibly damaging Het
Il25 G A 14: 54,933,158 A63T probably benign Het
Krt27 T A 11: 99,346,814 N366I probably benign Het
Mfge8 A G 7: 79,142,520 V219A probably benign Het
Nrbp1 T C 5: 31,249,946 V373A probably damaging Het
Olfr1186 A G 2: 88,526,486 N301S probably benign Het
Pcdh20 A G 14: 88,469,171 I231T probably damaging Het
Pfkp A G 13: 6,581,567 W151R probably damaging Het
Pikfyve T C 1: 65,246,854 I1084T probably benign Het
Poteg T C 8: 27,449,895 C27R probably damaging Het
Ptprz1 G A 6: 23,044,346 V1266M probably damaging Het
Rpa1 T C 11: 75,312,802 D358G probably damaging Het
Snapc4 A G 2: 26,369,953 S495P probably damaging Het
Surf6 A G 2: 26,899,356 I123T probably damaging Het
Trim3 A T 7: 105,618,214 S319R probably damaging Het
Trmt11 A G 10: 30,590,934 F72L probably benign Het
Tsks C T 7: 44,943,792 R61W probably damaging Het
Ube2k T C 5: 65,581,429 V36A possibly damaging Het
Ube3a T C 7: 59,288,413 V688A probably damaging Het
Vegfc A G 8: 54,157,045 K79E possibly damaging Het
Vmn1r77 G A 7: 12,041,834 R179Q probably benign Het
Vmn2r97 T A 17: 18,914,367 F16I probably benign Het
Zfp451 A T 1: 33,802,167 probably benign Het
Zfp600 C T 4: 146,195,322 Q187* probably null Het
Other mutations in Sybu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01453:Sybu APN 15 44672805 missense probably damaging 1.00
IGL02211:Sybu APN 15 44673466 missense probably damaging 1.00
IGL02303:Sybu APN 15 44673223 missense probably benign 0.03
E7848:Sybu UTSW 15 44673422 missense probably benign 0.32
R0015:Sybu UTSW 15 44673500 missense probably damaging 0.99
R0015:Sybu UTSW 15 44673500 missense probably damaging 0.99
R0064:Sybu UTSW 15 44672993 missense probably benign 0.00
R0064:Sybu UTSW 15 44672993 missense probably benign 0.00
R0413:Sybu UTSW 15 44673272 missense probably damaging 1.00
R0650:Sybu UTSW 15 44673268 missense probably benign 0.08
R1147:Sybu UTSW 15 44746255 missense probably damaging 1.00
R1147:Sybu UTSW 15 44746255 missense probably damaging 1.00
R1307:Sybu UTSW 15 44675390 missense probably damaging 1.00
R1568:Sybu UTSW 15 44718832 nonsense probably null
R2112:Sybu UTSW 15 44673335 missense probably benign 0.06
R2967:Sybu UTSW 15 44746356 missense probably damaging 1.00
R3120:Sybu UTSW 15 44672959 missense possibly damaging 0.88
R3429:Sybu UTSW 15 44746458 missense probably damaging 0.98
R3508:Sybu UTSW 15 44673082 missense probably damaging 1.00
R3720:Sybu UTSW 15 44672632 missense possibly damaging 0.89
R4080:Sybu UTSW 15 44718943 missense probably damaging 1.00
R4898:Sybu UTSW 15 44675499 missense probably benign 0.02
R4975:Sybu UTSW 15 44677667 missense probably damaging 1.00
R5066:Sybu UTSW 15 44677644 missense probably damaging 1.00
R5783:Sybu UTSW 15 44746414 missense probably damaging 0.96
R5913:Sybu UTSW 15 44787621 missense probably damaging 1.00
R6977:Sybu UTSW 15 44677695 missense probably benign 0.00
R7139:Sybu UTSW 15 44677714 missense possibly damaging 0.93
R7328:Sybu UTSW 15 44787794 missense not run
R7543:Sybu UTSW 15 44683452 critical splice acceptor site probably null
R7851:Sybu UTSW 15 44746456 nonsense probably null
R7909:Sybu UTSW 15 44673037 nonsense probably null
Z1177:Sybu UTSW 15 44673062 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGCATTCAATTAGGAGGCAAC -3'
(R):5'- TGCTCATGATACAAGGAGAGC -3'

Sequencing Primer
(F):5'- GCAACTGGGGACTTACCTC -3'
(R):5'- GCAAATATCAGTGGCCATATGC -3'
Posted On2019-05-13