Incidental Mutation 'R7044:Vmn2r97'
ID 547230
Institutional Source Beutler Lab
Gene Symbol Vmn2r97
Ensembl Gene ENSMUSG00000091491
Gene Name vomeronasal 2, receptor 97
Synonyms EG627367
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R7044 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 18914300-18958087 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 18914367 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 16 (F16I)
Ref Sequence ENSEMBL: ENSMUSP00000156141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168710] [ENSMUST00000232219]
AlphaFold K7N6Z2
Predicted Effect probably benign
Transcript: ENSMUST00000168710
AA Change: F16I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000129313
Gene: ENSMUSG00000091491
AA Change: F16I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 82 442 2.9e-36 PFAM
Pfam:NCD3G 513 566 4.9e-21 PFAM
Pfam:7tm_3 599 834 1.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232219
AA Change: F16I

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,612,280 D1169N possibly damaging Het
Ankrd6 T A 4: 32,815,260 Q448L possibly damaging Het
Appl1 A G 14: 26,928,677 S513P possibly damaging Het
Cdhr2 A T 13: 54,733,321 K1066* probably null Het
Ckap5 T C 2: 91,577,601 I824T probably benign Het
Ctbp2 T C 7: 133,015,102 R35G possibly damaging Het
Dcdc2c T C 12: 28,470,494 probably benign Het
Eya1 T A 1: 14,231,410 probably null Het
Fam105a A G 15: 27,657,235 probably benign Het
Fam207a T C 10: 77,514,392 D35G possibly damaging Het
Fat4 G C 3: 39,010,810 A4972P probably benign Het
Fat4 C T 3: 39,010,811 A4972V probably benign Het
Fbxl8 T A 8: 105,267,015 M1K probably null Het
Glyat T C 19: 12,650,265 S75P probably benign Het
Gm3543 T A 14: 41,980,066 I154F probably damaging Het
Gm4565 T A 7: 22,583,370 M8L probably benign Het
Gpr179 T C 11: 97,349,790 Q269R probably benign Het
Hfe2 C A 3: 96,527,474 H176Q possibly damaging Het
Ikzf2 T C 1: 69,538,901 H483R possibly damaging Het
Il25 G A 14: 54,933,158 A63T probably benign Het
Krt27 T A 11: 99,346,814 N366I probably benign Het
Mfge8 A G 7: 79,142,520 V219A probably benign Het
Nrbp1 T C 5: 31,249,946 V373A probably damaging Het
Olfr1186 A G 2: 88,526,486 N301S probably benign Het
Pcdh20 A G 14: 88,469,171 I231T probably damaging Het
Pfkp A G 13: 6,581,567 W151R probably damaging Het
Pikfyve T C 1: 65,246,854 I1084T probably benign Het
Poteg T C 8: 27,449,895 C27R probably damaging Het
Ptprz1 G A 6: 23,044,346 V1266M probably damaging Het
Rpa1 T C 11: 75,312,802 D358G probably damaging Het
Snapc4 A G 2: 26,369,953 S495P probably damaging Het
Surf6 A G 2: 26,899,356 I123T probably damaging Het
Sybu A T 15: 44,677,695 S324T possibly damaging Het
Trim3 A T 7: 105,618,214 S319R probably damaging Het
Trmt11 A G 10: 30,590,934 F72L probably benign Het
Tsks C T 7: 44,943,792 R61W probably damaging Het
Ube2k T C 5: 65,581,429 V36A possibly damaging Het
Ube3a T C 7: 59,288,413 V688A probably damaging Het
Vegfc A G 8: 54,157,045 K79E possibly damaging Het
Vmn1r77 G A 7: 12,041,834 R179Q probably benign Het
Zfp451 A T 1: 33,802,167 probably benign Het
Zfp600 C T 4: 146,195,322 Q187* probably null Het
Other mutations in Vmn2r97
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r97 APN 17 18947659 missense probably benign 0.37
IGL00962:Vmn2r97 APN 17 18929228 missense probably damaging 1.00
IGL01704:Vmn2r97 APN 17 18947811 missense probably damaging 0.99
IGL01888:Vmn2r97 APN 17 18929024 nonsense probably null
IGL02429:Vmn2r97 APN 17 18930334 missense possibly damaging 0.94
IGL02742:Vmn2r97 APN 17 18929170 missense probably damaging 0.97
IGL02934:Vmn2r97 APN 17 18929685 missense probably benign 0.00
IGL02978:Vmn2r97 APN 17 18948036 missense probably benign 0.01
IGL03230:Vmn2r97 APN 17 18929406 missense probably benign 0.10
IGL03241:Vmn2r97 APN 17 18928176 missense probably benign 0.11
IGL03050:Vmn2r97 UTSW 17 18947638 missense possibly damaging 0.84
PIT4469001:Vmn2r97 UTSW 17 18929616 missense probably benign 0.00
R0482:Vmn2r97 UTSW 17 18947668 missense probably damaging 1.00
R0514:Vmn2r97 UTSW 17 18914472 missense probably benign 0.25
R0944:Vmn2r97 UTSW 17 18947403 missense probably benign 0.13
R1061:Vmn2r97 UTSW 17 18928178 nonsense probably null
R1546:Vmn2r97 UTSW 17 18947848 missense probably damaging 1.00
R1725:Vmn2r97 UTSW 17 18929135 missense probably benign 0.43
R1860:Vmn2r97 UTSW 17 18947386 missense probably benign 0.01
R1938:Vmn2r97 UTSW 17 18929331 missense probably benign 0.01
R1944:Vmn2r97 UTSW 17 18940238 missense probably benign 0.00
R2027:Vmn2r97 UTSW 17 18929682 missense unknown
R2106:Vmn2r97 UTSW 17 18947838 missense probably damaging 1.00
R2151:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2153:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2154:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2516:Vmn2r97 UTSW 17 18947552 missense probably benign
R3739:Vmn2r97 UTSW 17 18928151 missense probably damaging 1.00
R3744:Vmn2r97 UTSW 17 18929628 missense probably benign
R3885:Vmn2r97 UTSW 17 18928334 missense possibly damaging 0.90
R3899:Vmn2r97 UTSW 17 18947611 missense probably damaging 0.96
R4115:Vmn2r97 UTSW 17 18928070 missense probably benign 0.01
R4247:Vmn2r97 UTSW 17 18947280 missense possibly damaging 0.83
R4287:Vmn2r97 UTSW 17 18948075 intron probably benign
R4439:Vmn2r97 UTSW 17 18930354 missense probably benign 0.00
R4523:Vmn2r97 UTSW 17 18929071 missense probably benign 0.03
R4783:Vmn2r97 UTSW 17 18929288 missense probably benign
R4948:Vmn2r97 UTSW 17 18947299 missense possibly damaging 0.95
R4981:Vmn2r97 UTSW 17 18940174 nonsense probably null
R5029:Vmn2r97 UTSW 17 18947911 missense probably damaging 1.00
R5200:Vmn2r97 UTSW 17 18928353 missense probably damaging 1.00
R5541:Vmn2r97 UTSW 17 18928355 nonsense probably null
R5637:Vmn2r97 UTSW 17 18947366 nonsense probably null
R5765:Vmn2r97 UTSW 17 18947180 nonsense probably null
R5885:Vmn2r97 UTSW 17 18947773 missense possibly damaging 0.50
R6272:Vmn2r97 UTSW 17 18947599 missense possibly damaging 0.70
R6553:Vmn2r97 UTSW 17 18930304 nonsense probably null
R6818:Vmn2r97 UTSW 17 18947931 missense possibly damaging 0.95
R6880:Vmn2r97 UTSW 17 18914508 missense probably benign 0.00
R7012:Vmn2r97 UTSW 17 18947494 missense probably damaging 0.99
R7023:Vmn2r97 UTSW 17 18914401 missense probably damaging 1.00
R7191:Vmn2r97 UTSW 17 18930286 missense probably damaging 1.00
R7503:Vmn2r97 UTSW 17 18928208 missense probably benign
R7862:Vmn2r97 UTSW 17 18947154 missense probably damaging 1.00
R7876:Vmn2r97 UTSW 17 18929064 missense probably damaging 0.97
R7890:Vmn2r97 UTSW 17 18929540 missense probably benign 0.00
R7936:Vmn2r97 UTSW 17 18930400 missense probably damaging 1.00
R7978:Vmn2r97 UTSW 17 18947592 missense probably damaging 1.00
R8405:Vmn2r97 UTSW 17 18914540 critical splice donor site probably null
R8755:Vmn2r97 UTSW 17 18947842 missense probably damaging 1.00
R8790:Vmn2r97 UTSW 17 18940210 missense probably damaging 1.00
R8850:Vmn2r97 UTSW 17 18929345 missense probably benign 0.00
R9060:Vmn2r97 UTSW 17 18914323 start codon destroyed probably null 0.94
R9079:Vmn2r97 UTSW 17 18929378 missense probably benign
R9252:Vmn2r97 UTSW 17 18947587 missense probably benign 0.00
R9278:Vmn2r97 UTSW 17 18914500 missense probably benign 0.00
R9342:Vmn2r97 UTSW 17 18929106 missense probably benign
R9422:Vmn2r97 UTSW 17 18929071 missense probably benign 0.03
R9496:Vmn2r97 UTSW 17 18928965 missense probably damaging 1.00
R9571:Vmn2r97 UTSW 17 18929657 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTCAGTAGCAGAGTCCATGTG -3'
(R):5'- TGAACTCACTGTATGACATTGTCC -3'

Sequencing Primer
(F):5'- AATCCCTTGGAATAATCAGTGTGGC -3'
(R):5'- CTCACTGTATGACATTGTCCAAATAG -3'
Posted On 2019-05-13