Incidental Mutation 'R7045:Strc'
ID547236
Institutional Source Beutler Lab
Gene Symbol Strc
Ensembl Gene ENSMUSG00000033498
Gene Namestereocilin
SynonymsDFNB16
Accession Numbers

Genbank: NM_080459; MGI: 2153816

Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R7045 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location121363728-121387168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121370726 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1296 (L1296Q)
Ref Sequence ENSEMBL: ENSMUSP00000039378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038389] [ENSMUST00000129136]
Predicted Effect probably damaging
Transcript: ENSMUST00000038389
AA Change: L1296Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: L1296Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 74 87 N/A INTRINSIC
low complexity region 108 119 N/A INTRINSIC
low complexity region 132 161 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 376 425 N/A INTRINSIC
low complexity region 610 635 N/A INTRINSIC
low complexity region 656 677 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1168 1194 N/A INTRINSIC
low complexity region 1287 1302 N/A INTRINSIC
low complexity region 1560 1580 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129136
SMART Domains Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

DomainStartEndE-ValueType
low complexity region 26 49 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt1 A T 12: 112,662,301 Y18* probably null Het
Ank2 C A 3: 127,012,744 A583S probably damaging Het
Atp8b4 T C 2: 126,372,195 N706S probably benign Het
Bace2 A G 16: 97,399,665 N111S probably damaging Het
Cnp A T 11: 100,580,358 R275S probably benign Het
Cs T A 10: 128,352,717 M104K probably benign Het
Ctcfl G A 2: 173,112,374 T310I probably damaging Het
Cyp2d40 T C 15: 82,761,562 I81V probably benign Het
Ddx19a A G 8: 110,993,074 V30A probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dock6 G A 9: 21,821,811 A1062V probably damaging Het
Dpysl2 T C 14: 66,829,946 D172G probably benign Het
Eml2 A G 7: 19,201,579 D638G probably damaging Het
Epb41l4b C A 4: 57,103,522 A105S possibly damaging Het
Fam198a T C 9: 121,965,641 L287P probably damaging Het
Fat4 A G 3: 38,888,601 I548V probably benign Het
Gabrb2 G A 11: 42,593,931 A272T probably damaging Het
Hcn1 C T 13: 117,975,462 P654L unknown Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hk1 C A 10: 62,286,570 G477C probably damaging Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Kiss1r A G 10: 79,919,425 probably null Het
L3mbtl4 G T 17: 68,461,566 R223L probably benign Het
Loxl4 G T 19: 42,606,635 N200K probably damaging Het
Lrba T C 3: 86,285,091 V104A probably benign Het
Lyst T A 13: 13,634,900 V385D probably benign Het
Lyst T A 13: 13,637,708 C902S probably damaging Het
Mrpl28 T C 17: 26,126,287 F227S probably benign Het
Mtmr3 A T 11: 4,498,896 V289E possibly damaging Het
Ndst3 A G 3: 123,672,083 V80A probably damaging Het
Nid2 C T 14: 19,779,681 A680V possibly damaging Het
Nudcd1 T C 15: 44,405,830 N145D probably benign Het
Nup210 A T 6: 91,054,451 I812N probably damaging Het
Olfr1008 A G 2: 85,689,911 S161G possibly damaging Het
Olfr130 C T 17: 38,067,971 H267Y probably benign Het
Olfr1390 A T 11: 49,340,930 T133S probably damaging Het
Olfr1468-ps1 C A 19: 13,374,972 N3K probably damaging Het
Olfr251 T A 9: 38,378,433 M184K probably damaging Het
Olfr319 A T 11: 58,701,669 probably benign Het
Olfr503 A G 7: 108,545,245 K238R probably damaging Het
Pcdhb6 A C 18: 37,336,276 Q750P possibly damaging Het
Plppr4 T C 3: 117,360,034 Y72C probably damaging Het
Rasgrf2 G T 13: 92,022,592 probably benign Het
Sbk2 A G 7: 4,958,906 I127T probably damaging Het
Smchd1 A C 17: 71,415,044 S817A probably benign Het
Speer4b A T 5: 27,500,125 N83K probably damaging Het
Svs1 T C 6: 48,988,612 V518A possibly damaging Het
Thap11 C A 8: 105,855,583 R75S possibly damaging Het
Unc13a A C 8: 71,658,763 L268R possibly damaging Het
Zfp39 A T 11: 58,890,443 C498S unknown Het
Zfp507 T C 7: 35,795,553 T22A possibly damaging Het
Zfp85 T C 13: 67,749,593 Y120C probably benign Het
Zfp882 G A 8: 71,913,249 probably null Het
Other mutations in Strc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Strc APN 2 121365060 missense probably benign 0.39
IGL01152:Strc APN 2 121370795 missense probably benign
IGL01608:Strc APN 2 121375594 missense probably benign 0.05
IGL01695:Strc APN 2 121375298 missense probably damaging 1.00
IGL01715:Strc APN 2 121365737 unclassified probably null
IGL01906:Strc APN 2 121377634 missense probably benign
IGL02135:Strc APN 2 121364834 missense probably damaging 1.00
IGL02416:Strc APN 2 121369058 missense probably damaging 1.00
IGL02455:Strc APN 2 121375791 unclassified probably benign
IGL03029:Strc APN 2 121364044 missense possibly damaging 0.95
IGL03176:Strc APN 2 121372180 missense probably damaging 0.99
IGL03272:Strc APN 2 121371751 missense probably damaging 1.00
3-1:Strc UTSW 2 121373680 missense probably damaging 0.99
IGL02799:Strc UTSW 2 121379236 missense probably damaging 1.00
PIT4283001:Strc UTSW 2 121375307 missense probably damaging 1.00
R0022:Strc UTSW 2 121368393 missense probably damaging 1.00
R0494:Strc UTSW 2 121379533 missense probably damaging 0.99
R1065:Strc UTSW 2 121366651 missense probably damaging 1.00
R1148:Strc UTSW 2 121372077 intron probably benign
R1148:Strc UTSW 2 121372077 intron probably benign
R1203:Strc UTSW 2 121372123 missense possibly damaging 0.66
R1343:Strc UTSW 2 121365115 missense probably benign 0.21
R1544:Strc UTSW 2 121372738 splice site probably null
R1650:Strc UTSW 2 121380885 start gained probably benign
R1840:Strc UTSW 2 121379296 missense probably damaging 1.00
R1983:Strc UTSW 2 121371037 missense possibly damaging 0.54
R2035:Strc UTSW 2 121374934 missense probably damaging 1.00
R2058:Strc UTSW 2 121378887 missense probably damaging 1.00
R2158:Strc UTSW 2 121365862 missense probably benign 0.10
R2219:Strc UTSW 2 121364523 missense probably damaging 1.00
R2680:Strc UTSW 2 121365111 missense probably damaging 0.99
R4375:Strc UTSW 2 121380823 missense unknown
R4563:Strc UTSW 2 121365805 missense probably benign 0.02
R4578:Strc UTSW 2 121378003 missense possibly damaging 0.94
R4607:Strc UTSW 2 121372945 missense probably benign 0.31
R4651:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4652:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4790:Strc UTSW 2 121375594 missense probably benign 0.05
R5480:Strc UTSW 2 121364819 missense probably benign 0.00
R5580:Strc UTSW 2 121375012 missense probably damaging 0.99
R5679:Strc UTSW 2 121368100 missense probably benign 0.03
R5703:Strc UTSW 2 121370814 missense probably benign
R5841:Strc UTSW 2 121365877 missense probably benign 0.29
R5917:Strc UTSW 2 121379309 missense probably benign
R5958:Strc UTSW 2 121376922 missense possibly damaging 0.56
R6320:Strc UTSW 2 121374958 missense probably benign 0.16
R6619:Strc UTSW 2 121368432 missense probably damaging 0.99
R6695:Strc UTSW 2 121377224 missense probably benign 0.35
R6970:Strc UTSW 2 121378014 missense probably benign 0.41
R7018:Strc UTSW 2 121369058 missense probably damaging 1.00
R7190:Strc UTSW 2 121369026 missense probably benign 0.14
R7283:Strc UTSW 2 121379452 missense probably damaging 0.99
R7694:Strc UTSW 2 121377096 missense probably damaging 1.00
R7699:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7700:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7756:Strc UTSW 2 121370946 missense probably benign
R7758:Strc UTSW 2 121370946 missense probably benign
R7822:Strc UTSW 2 121377738 missense probably benign 0.01
R7830:Strc UTSW 2 121375049 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTGGCACAGTATAAGCTTCCCTG -3'
(R):5'- TACTAGTGGGAGGCTTGGAC -3'

Sequencing Primer
(F):5'- CAGTATAAGCTTCCCTGTACCAG -3'
(R):5'- AGGCTTGGACCCTTGGTTC -3'
Posted On2019-05-13