Incidental Mutation 'R7045:Svs1'
ID547246
Institutional Source Beutler Lab
Gene Symbol Svs1
Ensembl Gene ENSMUSG00000039215
Gene Nameseminal vesicle secretory protein 1
SynonymsSVS I
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R7045 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location48986861-48991722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48988612 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 518 (V518A)
Ref Sequence ENSEMBL: ENSMUSP00000045221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037696]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037696
AA Change: V518A

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045221
Gene: ENSMUSG00000039215
AA Change: V518A

DomainStartEndE-ValueType
Pfam:Cu_amine_oxidN2 44 130 1.5e-24 PFAM
Pfam:Cu_amine_oxidN3 146 246 2.7e-16 PFAM
internal_repeat_1 286 342 7.28e-22 PROSPERO
Pfam:Cu_amine_oxid 408 811 2e-92 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt1 A T 12: 112,662,301 Y18* probably null Het
Ank2 C A 3: 127,012,744 A583S probably damaging Het
Atp8b4 T C 2: 126,372,195 N706S probably benign Het
Bace2 A G 16: 97,399,665 N111S probably damaging Het
Cnp A T 11: 100,580,358 R275S probably benign Het
Cs T A 10: 128,352,717 M104K probably benign Het
Ctcfl G A 2: 173,112,374 T310I probably damaging Het
Cyp2d40 T C 15: 82,761,562 I81V probably benign Het
Ddx19a A G 8: 110,993,074 V30A probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dock6 G A 9: 21,821,811 A1062V probably damaging Het
Dpysl2 T C 14: 66,829,946 D172G probably benign Het
Eml2 A G 7: 19,201,579 D638G probably damaging Het
Epb41l4b C A 4: 57,103,522 A105S possibly damaging Het
Fam198a T C 9: 121,965,641 L287P probably damaging Het
Fat4 A G 3: 38,888,601 I548V probably benign Het
Gabrb2 G A 11: 42,593,931 A272T probably damaging Het
Hcn1 C T 13: 117,975,462 P654L unknown Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hk1 C A 10: 62,286,570 G477C probably damaging Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Kiss1r A G 10: 79,919,425 probably null Het
L3mbtl4 G T 17: 68,461,566 R223L probably benign Het
Loxl4 G T 19: 42,606,635 N200K probably damaging Het
Lrba T C 3: 86,285,091 V104A probably benign Het
Lyst T A 13: 13,634,900 V385D probably benign Het
Lyst T A 13: 13,637,708 C902S probably damaging Het
Mrpl28 T C 17: 26,126,287 F227S probably benign Het
Mtmr3 A T 11: 4,498,896 V289E possibly damaging Het
Ndst3 A G 3: 123,672,083 V80A probably damaging Het
Nid2 C T 14: 19,779,681 A680V possibly damaging Het
Nudcd1 T C 15: 44,405,830 N145D probably benign Het
Nup210 A T 6: 91,054,451 I812N probably damaging Het
Olfr1008 A G 2: 85,689,911 S161G possibly damaging Het
Olfr130 C T 17: 38,067,971 H267Y probably benign Het
Olfr1390 A T 11: 49,340,930 T133S probably damaging Het
Olfr1468-ps1 C A 19: 13,374,972 N3K probably damaging Het
Olfr251 T A 9: 38,378,433 M184K probably damaging Het
Olfr319 A T 11: 58,701,669 probably benign Het
Olfr503 A G 7: 108,545,245 K238R probably damaging Het
Pcdhb6 A C 18: 37,336,276 Q750P possibly damaging Het
Plppr4 T C 3: 117,360,034 Y72C probably damaging Het
Rasgrf2 G T 13: 92,022,592 probably benign Het
Sbk2 A G 7: 4,958,906 I127T probably damaging Het
Smchd1 A C 17: 71,415,044 S817A probably benign Het
Speer4b A T 5: 27,500,125 N83K probably damaging Het
Strc A T 2: 121,370,726 L1296Q probably damaging Het
Thap11 C A 8: 105,855,583 R75S possibly damaging Het
Unc13a A C 8: 71,658,763 L268R possibly damaging Het
Zfp39 A T 11: 58,890,443 C498S unknown Het
Zfp507 T C 7: 35,795,553 T22A possibly damaging Het
Zfp85 T C 13: 67,749,593 Y120C probably benign Het
Zfp882 G A 8: 71,913,249 probably null Het
Other mutations in Svs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Svs1 APN 6 48987739 missense probably damaging 0.98
IGL01876:Svs1 APN 6 48990036 missense possibly damaging 0.71
IGL01934:Svs1 APN 6 48988761 missense probably damaging 0.97
IGL03002:Svs1 APN 6 48987118 missense probably benign 0.01
IGL03059:Svs1 APN 6 48987415 missense probably benign 0.13
IGL03213:Svs1 APN 6 48988345 missense possibly damaging 0.92
IGL03249:Svs1 APN 6 48988369 missense probably benign
IGL03365:Svs1 APN 6 48988597 missense probably damaging 0.97
PIT4280001:Svs1 UTSW 6 48987120 missense probably benign 0.01
PIT4495001:Svs1 UTSW 6 48987776 missense possibly damaging 0.92
R0010:Svs1 UTSW 6 48988906 missense probably damaging 0.99
R0528:Svs1 UTSW 6 48988031 missense probably benign
R0784:Svs1 UTSW 6 48987301 missense possibly damaging 0.78
R0959:Svs1 UTSW 6 48988632 missense possibly damaging 0.89
R1173:Svs1 UTSW 6 48990239 missense probably damaging 1.00
R1174:Svs1 UTSW 6 48990239 missense probably damaging 1.00
R1175:Svs1 UTSW 6 48990239 missense probably damaging 1.00
R1940:Svs1 UTSW 6 48990073 nonsense probably null
R3115:Svs1 UTSW 6 48987397 missense probably damaging 0.99
R3116:Svs1 UTSW 6 48987397 missense probably damaging 0.99
R3808:Svs1 UTSW 6 48987994 missense possibly damaging 0.93
R3809:Svs1 UTSW 6 48987994 missense possibly damaging 0.93
R3852:Svs1 UTSW 6 48987994 missense possibly damaging 0.93
R4455:Svs1 UTSW 6 48987460 missense possibly damaging 0.56
R4898:Svs1 UTSW 6 48987717 missense possibly damaging 0.95
R4933:Svs1 UTSW 6 48987492 missense probably damaging 1.00
R5108:Svs1 UTSW 6 48988570 missense probably damaging 0.97
R5320:Svs1 UTSW 6 48987575 missense probably benign 0.02
R6053:Svs1 UTSW 6 48988488 missense probably benign 0.42
R6728:Svs1 UTSW 6 48988845 missense possibly damaging 0.86
R6922:Svs1 UTSW 6 48987574 missense probably damaging 0.99
R7046:Svs1 UTSW 6 48987578 missense probably benign 0.11
R7137:Svs1 UTSW 6 48990149 missense probably damaging 1.00
R7267:Svs1 UTSW 6 48988018 small deletion probably benign
R7874:Svs1 UTSW 6 48988666 missense possibly damaging 0.91
R7993:Svs1 UTSW 6 48987608 missense possibly damaging 0.85
R8238:Svs1 UTSW 6 48990041 missense probably damaging 0.96
X0022:Svs1 UTSW 6 48988339 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCAAGAGGTTATGGCACTG -3'
(R):5'- AAGTGGCATGAACATACCCG -3'

Sequencing Primer
(F):5'- TTATGGCACTGTATAGAGGACACAC -3'
(R):5'- TCCATCATGCCATTGGAGTGGAAG -3'
Posted On2019-05-13