Incidental Mutation 'R7045:Zfp882'
ID547253
Institutional Source Beutler Lab
Gene Symbol Zfp882
Ensembl Gene ENSMUSG00000089857
Gene Namezinc finger protein 882
SynonymsENSMUSG00000052439
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R7045 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location71908608-71916354 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 71913249 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110002] [ENSMUST00000125802] [ENSMUST00000126607] [ENSMUST00000131544]
Predicted Effect probably null
Transcript: ENSMUST00000110002
SMART Domains Protein: ENSMUSP00000105629
Gene: ENSMUSG00000089857

DomainStartEndE-ValueType
KRAB 4 61 8.58e-14 SMART
ZnF_C2H2 84 106 1.47e-3 SMART
ZnF_C2H2 168 190 8.47e-4 SMART
ZnF_C2H2 196 218 2.27e-4 SMART
ZnF_C2H2 224 246 6.31e1 SMART
ZnF_C2H2 251 273 1.16e-1 SMART
ZnF_C2H2 279 301 1.25e-1 SMART
ZnF_C2H2 307 329 5.42e-2 SMART
ZnF_C2H2 335 357 1.47e-3 SMART
ZnF_C2H2 363 385 7.26e-3 SMART
ZnF_C2H2 391 413 1.26e-2 SMART
ZnF_C2H2 419 441 3.29e1 SMART
ZnF_C2H2 447 469 2.67e-1 SMART
ZnF_C2H2 475 497 1.04e-3 SMART
ZnF_C2H2 503 525 4.11e-2 SMART
ZnF_C2H2 531 553 4.87e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000125802
SMART Domains Protein: ENSMUSP00000121316
Gene: ENSMUSG00000089857

DomainStartEndE-ValueType
KRAB 12 69 8.58e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000126607
SMART Domains Protein: ENSMUSP00000119978
Gene: ENSMUSG00000089857

DomainStartEndE-ValueType
KRAB 44 101 8.58e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131544
SMART Domains Protein: ENSMUSP00000120213
Gene: ENSMUSG00000066880

DomainStartEndE-ValueType
KRAB 4 56 1.08e-10 SMART
ZnF_C2H2 167 189 8.47e-4 SMART
ZnF_C2H2 195 217 8.34e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt1 A T 12: 112,662,301 Y18* probably null Het
Ank2 C A 3: 127,012,744 A583S probably damaging Het
Atp8b4 T C 2: 126,372,195 N706S probably benign Het
Bace2 A G 16: 97,399,665 N111S probably damaging Het
Cnp A T 11: 100,580,358 R275S probably benign Het
Cs T A 10: 128,352,717 M104K probably benign Het
Ctcfl G A 2: 173,112,374 T310I probably damaging Het
Cyp2d40 T C 15: 82,761,562 I81V probably benign Het
Ddx19a A G 8: 110,993,074 V30A probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dock6 G A 9: 21,821,811 A1062V probably damaging Het
Dpysl2 T C 14: 66,829,946 D172G probably benign Het
Eml2 A G 7: 19,201,579 D638G probably damaging Het
Epb41l4b C A 4: 57,103,522 A105S possibly damaging Het
Fam198a T C 9: 121,965,641 L287P probably damaging Het
Fat4 A G 3: 38,888,601 I548V probably benign Het
Gabrb2 G A 11: 42,593,931 A272T probably damaging Het
Hcn1 C T 13: 117,975,462 P654L unknown Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hk1 C A 10: 62,286,570 G477C probably damaging Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Kiss1r A G 10: 79,919,425 probably null Het
L3mbtl4 G T 17: 68,461,566 R223L probably benign Het
Loxl4 G T 19: 42,606,635 N200K probably damaging Het
Lrba T C 3: 86,285,091 V104A probably benign Het
Lyst T A 13: 13,634,900 V385D probably benign Het
Lyst T A 13: 13,637,708 C902S probably damaging Het
Mrpl28 T C 17: 26,126,287 F227S probably benign Het
Mtmr3 A T 11: 4,498,896 V289E possibly damaging Het
Ndst3 A G 3: 123,672,083 V80A probably damaging Het
Nid2 C T 14: 19,779,681 A680V possibly damaging Het
Nudcd1 T C 15: 44,405,830 N145D probably benign Het
Nup210 A T 6: 91,054,451 I812N probably damaging Het
Olfr1008 A G 2: 85,689,911 S161G possibly damaging Het
Olfr130 C T 17: 38,067,971 H267Y probably benign Het
Olfr1390 A T 11: 49,340,930 T133S probably damaging Het
Olfr1468-ps1 C A 19: 13,374,972 N3K probably damaging Het
Olfr251 T A 9: 38,378,433 M184K probably damaging Het
Olfr319 A T 11: 58,701,669 probably benign Het
Olfr503 A G 7: 108,545,245 K238R probably damaging Het
Pcdhb6 A C 18: 37,336,276 Q750P possibly damaging Het
Plppr4 T C 3: 117,360,034 Y72C probably damaging Het
Rasgrf2 G T 13: 92,022,592 probably benign Het
Sbk2 A G 7: 4,958,906 I127T probably damaging Het
Smchd1 A C 17: 71,415,044 S817A probably benign Het
Speer4b A T 5: 27,500,125 N83K probably damaging Het
Strc A T 2: 121,370,726 L1296Q probably damaging Het
Svs1 T C 6: 48,988,612 V518A possibly damaging Het
Thap11 C A 8: 105,855,583 R75S possibly damaging Het
Unc13a A C 8: 71,658,763 L268R possibly damaging Het
Zfp39 A T 11: 58,890,443 C498S unknown Het
Zfp507 T C 7: 35,795,553 T22A possibly damaging Het
Zfp85 T C 13: 67,749,593 Y120C probably benign Het
Other mutations in Zfp882
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Zfp882 APN 8 71913827 missense probably benign
R0244:Zfp882 UTSW 8 71913523 missense possibly damaging 0.79
R0270:Zfp882 UTSW 8 71914615 missense probably benign 0.05
R0636:Zfp882 UTSW 8 71914337 missense probably benign 0.01
R0840:Zfp882 UTSW 8 71914686 nonsense probably null
R1299:Zfp882 UTSW 8 71913473 missense probably damaging 1.00
R4439:Zfp882 UTSW 8 71913609 missense probably damaging 0.97
R4829:Zfp882 UTSW 8 71914389 missense probably damaging 1.00
R5028:Zfp882 UTSW 8 71914654 missense possibly damaging 0.70
R5296:Zfp882 UTSW 8 71914360 missense probably damaging 1.00
R5882:Zfp882 UTSW 8 71913459 critical splice acceptor site probably null
R5974:Zfp882 UTSW 8 71913155 missense probably damaging 1.00
R6052:Zfp882 UTSW 8 71914505 missense probably benign 0.01
R6383:Zfp882 UTSW 8 71914640 missense probably damaging 1.00
R6888:Zfp882 UTSW 8 71914286 missense probably benign 0.01
R6987:Zfp882 UTSW 8 71914673 missense probably benign 0.01
R7780:Zfp882 UTSW 8 71914229 missense possibly damaging 0.89
R7793:Zfp882 UTSW 8 71913141 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCGCAGTCTCACATTAGAG -3'
(R):5'- TCAAGGATCCAGTCTTCTTGC -3'

Sequencing Primer
(F):5'- GAGTCTAGCTCTCCAATGCTGAG -3'
(R):5'- TGTACAAATCATGGAGCTTG -3'
Posted On2019-05-13