Incidental Mutation 'R0611:Abca14'
ID 54726
Institutional Source Beutler Lab
Gene Symbol Abca14
Ensembl Gene ENSMUSG00000062017
Gene Name ATP-binding cassette, sub-family A member 14
Synonyms 1700110B15Rik, 4930539G24Rik
MMRRC Submission 038800-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0611 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 119803184-119924575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119851479 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 819 (M819K)
Ref Sequence ENSEMBL: ENSMUSP00000081690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084640]
AlphaFold E9Q8F8
Predicted Effect possibly damaging
Transcript: ENSMUST00000084640
AA Change: M819K

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000081690
Gene: ENSMUSG00000062017
AA Change: M819K

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 463 5.7e-23 PFAM
AAA 548 729 1.59e-10 SMART
Pfam:ABC2_membrane_3 902 1296 1.2e-36 PFAM
AAA 1384 1568 1.33e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143257
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T G 7: 82,178,120 (GRCm39) C528G probably damaging Het
Akap9 A G 5: 4,004,870 (GRCm39) K148E probably benign Het
Akr1b1 A T 6: 34,286,577 (GRCm39) D225E probably benign Het
Alms1 C A 6: 85,655,653 (GRCm39) Q2931K possibly damaging Het
Ano3 T C 2: 110,715,346 (GRCm39) K31E possibly damaging Het
Cdc37 A G 9: 21,053,537 (GRCm39) I242T probably damaging Het
Celsr1 T A 15: 85,816,524 (GRCm39) K1806N possibly damaging Het
Clpb T A 7: 101,436,956 (GRCm39) I707N possibly damaging Het
Cntnap2 A T 6: 47,072,483 (GRCm39) Y1017F possibly damaging Het
Creb3l2 A T 6: 37,311,416 (GRCm39) S458T probably benign Het
Ctnnd2 C A 15: 31,009,230 (GRCm39) T1109K possibly damaging Het
Dcaf10 T A 4: 45,373,011 (GRCm39) L425Q probably damaging Het
Dlec1 A G 9: 118,941,167 (GRCm39) E239G probably benign Het
Dnah2 T C 11: 69,390,020 (GRCm39) K742E probably damaging Het
Dsp A T 13: 38,371,717 (GRCm39) R889S probably damaging Het
Dync1h1 T A 12: 110,599,222 (GRCm39) M1859K probably damaging Het
Efcab7 T A 4: 99,758,886 (GRCm39) N361K probably damaging Het
Eps8l2 T C 7: 140,935,646 (GRCm39) V139A probably damaging Het
Fads3 T G 19: 10,019,200 (GRCm39) H35Q probably damaging Het
Fam163b C A 2: 27,003,583 (GRCm39) V24F probably damaging Het
Gm14496 A T 2: 181,636,904 (GRCm39) T121S probably benign Het
Gm4799 C T 10: 82,790,563 (GRCm39) noncoding transcript Het
Gm7168 A T 17: 14,169,797 (GRCm39) D388V probably benign Het
Gmeb1 A T 4: 131,953,386 (GRCm39) L460* probably null Het
Gpc6 T G 14: 118,212,430 (GRCm39) F534V probably null Het
Hectd3 A G 4: 116,853,241 (GRCm39) D156G possibly damaging Het
Itga6 T C 2: 71,650,404 (GRCm39) I150T possibly damaging Het
Kansl1 A G 11: 104,229,012 (GRCm39) M863T probably benign Het
Kcnb2 A T 1: 15,780,664 (GRCm39) Y512F probably benign Het
Klhdc2 A T 12: 69,347,053 (GRCm39) M73L probably benign Het
Ktn1 A G 14: 47,932,073 (GRCm39) T667A probably benign Het
Lgsn A C 1: 31,242,736 (GRCm39) I273L probably benign Het
Lilra5 A G 7: 4,245,232 (GRCm39) D292G probably benign Het
Mrps27 C T 13: 99,541,582 (GRCm39) R229C probably damaging Het
Muc5b T G 7: 141,416,173 (GRCm39) S3040A probably benign Het
Nat14 T C 7: 4,926,275 (GRCm39) S7P probably damaging Het
Nfia A G 4: 97,671,694 (GRCm39) I135V possibly damaging Het
Nkd1 G A 8: 89,248,944 (GRCm39) A30T probably damaging Het
Nup205 A G 6: 35,202,903 (GRCm39) D1370G probably null Het
Or1j15 C G 2: 36,459,568 (GRCm39) probably null Het
Or4k15c G A 14: 50,321,310 (GRCm39) T276I probably damaging Het
Or51k2 T C 7: 103,596,400 (GRCm39) L209P probably damaging Het
Or5p79 T A 7: 108,221,494 (GRCm39) N158K possibly damaging Het
Or8s10 T C 15: 98,336,168 (GRCm39) S273P possibly damaging Het
Orc1 C T 4: 108,459,229 (GRCm39) A466V probably benign Het
Otud7a T A 7: 63,385,638 (GRCm39) D367E possibly damaging Het
Pcdhb4 A G 18: 37,441,263 (GRCm39) Y191C probably damaging Het
Pclo T C 5: 14,762,828 (GRCm39) V3767A unknown Het
Pclo T C 5: 14,728,789 (GRCm39) probably benign Het
Prmt1 A T 7: 44,628,225 (GRCm39) probably null Het
Ralgapa1 A G 12: 55,842,483 (GRCm39) F62S probably damaging Het
Rangrf T C 11: 68,863,518 (GRCm39) S163G probably benign Het
Rgs12 C A 5: 35,176,804 (GRCm39) A65E probably damaging Het
Rrbp1 T C 2: 143,830,436 (GRCm39) N577S probably damaging Het
Septin11 A G 5: 93,315,393 (GRCm39) H374R probably damaging Het
Serpina5 T G 12: 104,070,046 (GRCm39) N314K probably benign Het
Sgce T C 6: 4,689,621 (GRCm39) D395G probably damaging Het
Slc26a9 A T 1: 131,690,499 (GRCm39) N501I probably damaging Het
Slc9c1 A G 16: 45,401,965 (GRCm39) D784G possibly damaging Het
Snapc2 A G 8: 4,305,676 (GRCm39) D207G probably benign Het
Stard9 G T 2: 120,529,738 (GRCm39) M1998I probably benign Het
Stk38 A C 17: 29,194,907 (GRCm39) F280V possibly damaging Het
Tas2r126 A G 6: 42,412,025 (GRCm39) K186R probably damaging Het
Tdp1 A C 12: 99,875,970 (GRCm39) D307A probably benign Het
Tead2 A G 7: 44,866,674 (GRCm39) D11G probably damaging Het
Tmco4 C A 4: 138,747,383 (GRCm39) L211I probably damaging Het
Tmem183a A G 1: 134,280,115 (GRCm39) F255S probably damaging Het
Tmem87a C T 2: 120,205,929 (GRCm39) G349S possibly damaging Het
Tpte G A 8: 22,826,549 (GRCm39) E377K possibly damaging Het
Trim32 T C 4: 65,531,893 (GRCm39) F150S possibly damaging Het
Trpc7 T A 13: 57,035,636 (GRCm39) K99M probably damaging Het
Ttc22 A G 4: 106,491,381 (GRCm39) K195E probably damaging Het
Txn2 G A 15: 77,811,917 (GRCm39) P7S probably damaging Het
Ubxn2a G A 12: 4,930,700 (GRCm39) T220I probably damaging Het
Ufd1 A G 16: 18,633,626 (GRCm39) N17S possibly damaging Het
Unc13a A G 8: 72,102,509 (GRCm39) S958P probably damaging Het
Vmn1r202 T A 13: 22,685,824 (GRCm39) M198L probably damaging Het
Vmn2r84 G A 10: 130,221,991 (GRCm39) A743V probably damaging Het
Washc5 A G 15: 59,213,007 (GRCm39) F891S probably damaging Het
Zfp708 T C 13: 67,218,375 (GRCm39) T495A probably benign Het
Zfp81 A G 17: 33,553,593 (GRCm39) I407T probably benign Het
Zswim5 T C 4: 116,843,874 (GRCm39) probably null Het
Other mutations in Abca14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Abca14 APN 7 119,846,076 (GRCm39) missense probably damaging 1.00
IGL00800:Abca14 APN 7 119,854,613 (GRCm39) missense probably benign 0.01
IGL00845:Abca14 APN 7 119,823,174 (GRCm39) splice site probably benign
IGL00897:Abca14 APN 7 119,815,348 (GRCm39) splice site probably benign
IGL01524:Abca14 APN 7 119,852,644 (GRCm39) missense possibly damaging 0.57
IGL01747:Abca14 APN 7 119,877,310 (GRCm39) missense probably benign 0.00
IGL02214:Abca14 APN 7 119,893,398 (GRCm39) missense probably benign 0.09
IGL02215:Abca14 APN 7 119,852,612 (GRCm39) missense probably benign 0.00
IGL02253:Abca14 APN 7 119,807,182 (GRCm39) missense probably benign 0.29
IGL02302:Abca14 APN 7 119,917,968 (GRCm39) splice site probably benign
IGL03391:Abca14 APN 7 119,846,107 (GRCm39) missense probably damaging 1.00
F6893:Abca14 UTSW 7 119,924,261 (GRCm39) missense probably damaging 0.98
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0265:Abca14 UTSW 7 119,822,850 (GRCm39) missense probably benign 0.03
R0326:Abca14 UTSW 7 119,823,642 (GRCm39) missense probably damaging 1.00
R0380:Abca14 UTSW 7 119,877,703 (GRCm39) missense probably benign 0.03
R0418:Abca14 UTSW 7 119,806,657 (GRCm39) missense probably damaging 1.00
R0539:Abca14 UTSW 7 119,807,020 (GRCm39) missense probably damaging 1.00
R0574:Abca14 UTSW 7 119,823,720 (GRCm39) missense probably damaging 0.96
R0783:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0785:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0863:Abca14 UTSW 7 119,815,453 (GRCm39) missense probably benign 0.03
R1034:Abca14 UTSW 7 119,815,370 (GRCm39) missense probably damaging 1.00
R1056:Abca14 UTSW 7 119,924,295 (GRCm39) missense probably damaging 1.00
R1072:Abca14 UTSW 7 119,811,992 (GRCm39) missense probably benign
R1244:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1255:Abca14 UTSW 7 119,807,016 (GRCm39) missense probably damaging 0.97
R1271:Abca14 UTSW 7 119,924,340 (GRCm39) missense probably damaging 1.00
R1325:Abca14 UTSW 7 119,846,545 (GRCm39) missense probably benign 0.32
R1457:Abca14 UTSW 7 119,888,683 (GRCm39) missense probably benign 0.00
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1494:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R1551:Abca14 UTSW 7 119,918,101 (GRCm39) missense probably benign 0.10
R1607:Abca14 UTSW 7 119,850,514 (GRCm39) missense probably damaging 1.00
R1739:Abca14 UTSW 7 119,877,529 (GRCm39) missense probably benign 0.04
R1856:Abca14 UTSW 7 119,877,404 (GRCm39) missense probably damaging 1.00
R1875:Abca14 UTSW 7 119,847,190 (GRCm39) missense possibly damaging 0.78
R1892:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1898:Abca14 UTSW 7 119,850,392 (GRCm39) missense probably damaging 1.00
R1958:Abca14 UTSW 7 119,924,382 (GRCm39) missense probably damaging 0.98
R2018:Abca14 UTSW 7 119,815,408 (GRCm39) missense probably benign 0.00
R2039:Abca14 UTSW 7 119,911,487 (GRCm39) missense probably damaging 0.98
R2060:Abca14 UTSW 7 119,826,741 (GRCm39) nonsense probably null
R2202:Abca14 UTSW 7 119,888,764 (GRCm39) missense probably benign 0.17
R2205:Abca14 UTSW 7 119,846,503 (GRCm39) missense probably damaging 0.98
R2360:Abca14 UTSW 7 119,850,431 (GRCm39) missense probably benign 0.00
R2401:Abca14 UTSW 7 119,882,312 (GRCm39) missense probably damaging 1.00
R2426:Abca14 UTSW 7 119,882,446 (GRCm39) missense probably benign 0.04
R3433:Abca14 UTSW 7 119,893,455 (GRCm39) missense probably damaging 0.97
R4598:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4599:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4700:Abca14 UTSW 7 119,911,928 (GRCm39) critical splice donor site probably null
R4751:Abca14 UTSW 7 119,911,400 (GRCm39) missense probably benign 0.01
R4826:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4828:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4837:Abca14 UTSW 7 119,846,203 (GRCm39) missense probably benign
R4881:Abca14 UTSW 7 119,877,472 (GRCm39) missense possibly damaging 0.49
R4895:Abca14 UTSW 7 119,846,572 (GRCm39) critical splice donor site probably null
R4928:Abca14 UTSW 7 119,923,803 (GRCm39) missense possibly damaging 0.90
R4990:Abca14 UTSW 7 119,911,388 (GRCm39) missense probably benign 0.00
R5027:Abca14 UTSW 7 119,911,505 (GRCm39) missense probably benign 0.05
R5091:Abca14 UTSW 7 119,851,497 (GRCm39) missense probably damaging 1.00
R5158:Abca14 UTSW 7 119,852,652 (GRCm39) missense probably benign
R5209:Abca14 UTSW 7 119,832,130 (GRCm39) missense probably benign 0.01
R5333:Abca14 UTSW 7 119,888,769 (GRCm39) nonsense probably null
R5424:Abca14 UTSW 7 119,810,777 (GRCm39) missense probably benign 0.01
R5488:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5489:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5716:Abca14 UTSW 7 119,846,217 (GRCm39) critical splice donor site probably null
R6450:Abca14 UTSW 7 119,815,449 (GRCm39) missense probably benign 0.17
R6477:Abca14 UTSW 7 119,924,325 (GRCm39) missense probably benign 0.44
R6652:Abca14 UTSW 7 119,846,164 (GRCm39) missense probably damaging 1.00
R6782:Abca14 UTSW 7 119,847,308 (GRCm39) missense probably damaging 1.00
R6874:Abca14 UTSW 7 119,851,428 (GRCm39) missense possibly damaging 0.71
R6965:Abca14 UTSW 7 119,882,452 (GRCm39) nonsense probably null
R7142:Abca14 UTSW 7 119,850,406 (GRCm39) missense possibly damaging 0.89
R7146:Abca14 UTSW 7 119,854,520 (GRCm39) missense probably benign 0.15
R7202:Abca14 UTSW 7 119,917,236 (GRCm39) missense probably damaging 1.00
R7220:Abca14 UTSW 7 119,826,667 (GRCm39) missense possibly damaging 0.45
R7241:Abca14 UTSW 7 119,846,184 (GRCm39) missense probably damaging 1.00
R7291:Abca14 UTSW 7 119,888,832 (GRCm39) nonsense probably null
R7296:Abca14 UTSW 7 119,877,534 (GRCm39) missense probably benign
R7298:Abca14 UTSW 7 119,807,106 (GRCm39) missense probably benign 0.00
R7315:Abca14 UTSW 7 119,893,341 (GRCm39) missense probably benign 0.00
R7776:Abca14 UTSW 7 119,832,214 (GRCm39) critical splice donor site probably null
R7820:Abca14 UTSW 7 119,811,944 (GRCm39) missense probably benign 0.42
R7873:Abca14 UTSW 7 119,888,792 (GRCm39) missense probably benign 0.17
R8215:Abca14 UTSW 7 119,893,425 (GRCm39) missense probably benign
R8332:Abca14 UTSW 7 119,815,436 (GRCm39) missense probably benign
R8419:Abca14 UTSW 7 119,815,489 (GRCm39) missense probably benign 0.08
R8444:Abca14 UTSW 7 119,918,133 (GRCm39) missense probably damaging 1.00
R8818:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R8834:Abca14 UTSW 7 119,877,372 (GRCm39) missense probably benign 0.02
R8845:Abca14 UTSW 7 119,846,428 (GRCm39) missense probably benign 0.00
R8889:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8892:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8894:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably damaging 1.00
R8903:Abca14 UTSW 7 119,815,526 (GRCm39) missense probably damaging 0.98
R8950:Abca14 UTSW 7 119,823,595 (GRCm39) missense possibly damaging 0.92
R8950:Abca14 UTSW 7 119,823,644 (GRCm39) nonsense probably null
R9018:Abca14 UTSW 7 119,918,532 (GRCm39) missense probably damaging 0.98
R9018:Abca14 UTSW 7 119,888,763 (GRCm39) missense probably benign 0.01
R9110:Abca14 UTSW 7 119,831,615 (GRCm39) intron probably benign
R9254:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9376:Abca14 UTSW 7 119,893,438 (GRCm39) missense probably damaging 1.00
R9378:Abca14 UTSW 7 119,807,191 (GRCm39) missense possibly damaging 0.64
R9379:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9388:Abca14 UTSW 7 119,882,261 (GRCm39) missense probably benign 0.01
R9445:Abca14 UTSW 7 119,877,691 (GRCm39) missense probably benign 0.05
R9522:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably null 0.98
R9577:Abca14 UTSW 7 119,810,768 (GRCm39) missense probably benign 0.27
R9627:Abca14 UTSW 7 119,854,530 (GRCm39) missense probably benign 0.00
R9639:Abca14 UTSW 7 119,893,345 (GRCm39) missense probably benign 0.01
R9660:Abca14 UTSW 7 119,851,478 (GRCm39) missense probably benign 0.00
R9696:Abca14 UTSW 7 119,888,734 (GRCm39) missense possibly damaging 0.59
R9709:Abca14 UTSW 7 119,888,739 (GRCm39) nonsense probably null
R9780:Abca14 UTSW 7 119,911,447 (GRCm39) missense probably benign 0.00
Z1088:Abca14 UTSW 7 119,815,358 (GRCm39) missense probably benign 0.14
Z1176:Abca14 UTSW 7 119,846,146 (GRCm39) missense probably damaging 1.00
Z1177:Abca14 UTSW 7 119,917,210 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACACATGAATTGCACTGCTCAGG -3'
(R):5'- TGGATGCTGGAAATCAGAGCACAC -3'

Sequencing Primer
(F):5'- TTGCACTGCTCAGGGAAATTAG -3'
(R):5'- ATGAGGTCGCCTGACATGG -3'
Nature of Mutation

 Multiple transcripts of the Abca14 gene are displayed on Ensembl.

Protein Function and Prediction

The Abca14 gene encodes a 1683 amino acid protein that belongs to the ATP-binding cassette (ABC) transporter superfamily. These transporters use the hydrolysis of ATP to export or import a wide variety of substrates ranging from small ions to macromolecules. The members of the ABCA subfamily share a high degree of sequence conservation and function in lipid trafficking in several body locations. Abca14 has been cloned rat and mouse; no human orthologue has been described. The ABCA14 has two nucleotide-binding folds and two transmembrane domains.  Abca14 is predominantly expressed in testis, indicating that it may function in testicular development or spermatogenesis. 

Posted On 2013-07-11