Incidental Mutation 'R7045:Kiss1r'
ID547260
Institutional Source Beutler Lab
Gene Symbol Kiss1r
Ensembl Gene ENSMUSG00000035773
Gene NameKISS1 receptor
SynonymsGpr54
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7045 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location79916971-79922273 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 79919425 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045529] [ENSMUST00000045628] [ENSMUST00000171416] [ENSMUST00000217976] [ENSMUST00000218750] [ENSMUST00000218970] [ENSMUST00000219745] [ENSMUST00000219867]
Predicted Effect probably null
Transcript: ENSMUST00000045529
SMART Domains Protein: ENSMUSP00000040516
Gene: ENSMUSG00000035773

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 53 338 1.7e-6 PFAM
Pfam:7tm_1 59 323 7e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045628
SMART Domains Protein: ENSMUSP00000044570
Gene: ENSMUSG00000035781

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
Pfam:R3H-assoc 43 177 1.2e-35 PFAM
Pfam:R3H 181 244 7.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171416
SMART Domains Protein: ENSMUSP00000132266
Gene: ENSMUSG00000035781

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
Pfam:R3H-assoc 43 177 4.9e-39 PFAM
Pfam:R3H 183 243 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217976
Predicted Effect probably benign
Transcript: ENSMUST00000218750
Predicted Effect probably benign
Transcript: ENSMUST00000218970
Predicted Effect probably null
Transcript: ENSMUST00000219745
Predicted Effect probably benign
Transcript: ENSMUST00000219867
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a galanin-like G protein-coupled receptor that binds metastin, a peptide encoded by the metastasis suppressor gene KISS1. The tissue distribution of the expressed gene suggests that it is involved in the regulation of endocrine function, and this is supported by the finding that this gene appears to play a role in the onset of puberty. Mutations in this gene have been associated with hypogonadotropic hypogonadism and central precocious puberty. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutations result in male and female infertility associated with abnormal sexual maturation and hypogonadotropic hypogonadism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt1 A T 12: 112,662,301 Y18* probably null Het
Ank2 C A 3: 127,012,744 A583S probably damaging Het
Atp8b4 T C 2: 126,372,195 N706S probably benign Het
Bace2 A G 16: 97,399,665 N111S probably damaging Het
Cnp A T 11: 100,580,358 R275S probably benign Het
Cs T A 10: 128,352,717 M104K probably benign Het
Ctcfl G A 2: 173,112,374 T310I probably damaging Het
Cyp2d40 T C 15: 82,761,562 I81V probably benign Het
Ddx19a A G 8: 110,993,074 V30A probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dock6 G A 9: 21,821,811 A1062V probably damaging Het
Dpysl2 T C 14: 66,829,946 D172G probably benign Het
Eml2 A G 7: 19,201,579 D638G probably damaging Het
Epb41l4b C A 4: 57,103,522 A105S possibly damaging Het
Fam198a T C 9: 121,965,641 L287P probably damaging Het
Fat4 A G 3: 38,888,601 I548V probably benign Het
Gabrb2 G A 11: 42,593,931 A272T probably damaging Het
Hcn1 C T 13: 117,975,462 P654L unknown Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hk1 C A 10: 62,286,570 G477C probably damaging Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
L3mbtl4 G T 17: 68,461,566 R223L probably benign Het
Loxl4 G T 19: 42,606,635 N200K probably damaging Het
Lrba T C 3: 86,285,091 V104A probably benign Het
Lyst T A 13: 13,634,900 V385D probably benign Het
Lyst T A 13: 13,637,708 C902S probably damaging Het
Mrpl28 T C 17: 26,126,287 F227S probably benign Het
Mtmr3 A T 11: 4,498,896 V289E possibly damaging Het
Ndst3 A G 3: 123,672,083 V80A probably damaging Het
Nid2 C T 14: 19,779,681 A680V possibly damaging Het
Nudcd1 T C 15: 44,405,830 N145D probably benign Het
Nup210 A T 6: 91,054,451 I812N probably damaging Het
Olfr1008 A G 2: 85,689,911 S161G possibly damaging Het
Olfr130 C T 17: 38,067,971 H267Y probably benign Het
Olfr1390 A T 11: 49,340,930 T133S probably damaging Het
Olfr1468-ps1 C A 19: 13,374,972 N3K probably damaging Het
Olfr251 T A 9: 38,378,433 M184K probably damaging Het
Olfr319 A T 11: 58,701,669 probably benign Het
Olfr503 A G 7: 108,545,245 K238R probably damaging Het
Pcdhb6 A C 18: 37,336,276 Q750P possibly damaging Het
Plppr4 T C 3: 117,360,034 Y72C probably damaging Het
Rasgrf2 G T 13: 92,022,592 probably benign Het
Sbk2 A G 7: 4,958,906 I127T probably damaging Het
Smchd1 A C 17: 71,415,044 S817A probably benign Het
Speer4b A T 5: 27,500,125 N83K probably damaging Het
Strc A T 2: 121,370,726 L1296Q probably damaging Het
Svs1 T C 6: 48,988,612 V518A possibly damaging Het
Thap11 C A 8: 105,855,583 R75S possibly damaging Het
Unc13a A C 8: 71,658,763 L268R possibly damaging Het
Zfp39 A T 11: 58,890,443 C498S unknown Het
Zfp507 T C 7: 35,795,553 T22A possibly damaging Het
Zfp85 T C 13: 67,749,593 Y120C probably benign Het
Zfp882 G A 8: 71,913,249 probably null Het
Other mutations in Kiss1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Kiss1r APN 10 79918716 missense possibly damaging 0.67
IGL00954:Kiss1r APN 10 79922000 missense probably damaging 0.99
IGL01370:Kiss1r APN 10 79918824 missense probably benign 0.01
R0111:Kiss1r UTSW 10 79918689 missense possibly damaging 0.89
R1759:Kiss1r UTSW 10 79921778 missense probably damaging 1.00
R2348:Kiss1r UTSW 10 79921820 missense probably benign 0.34
R4654:Kiss1r UTSW 10 79921790 missense probably damaging 1.00
R5015:Kiss1r UTSW 10 79918807 missense probably damaging 1.00
R5072:Kiss1r UTSW 10 79918762 nonsense probably null
R5073:Kiss1r UTSW 10 79918762 nonsense probably null
R5074:Kiss1r UTSW 10 79918762 nonsense probably null
R5140:Kiss1r UTSW 10 79921627 missense probably damaging 1.00
R5253:Kiss1r UTSW 10 79920750 missense probably damaging 1.00
R5990:Kiss1r UTSW 10 79918707 missense probably benign 0.02
R6625:Kiss1r UTSW 10 79919534 missense possibly damaging 0.72
R7051:Kiss1r UTSW 10 79918854 missense probably damaging 1.00
R7161:Kiss1r UTSW 10 79919489 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACTGGCACCGGTAGCTTG -3'
(R):5'- AGGCCTCATTTCAGGTCCTG -3'

Sequencing Primer
(F):5'- CACCGGTAGCTTGGGATTATCC -3'
(R):5'- AGGTCTGGTCCTGCCCATAC -3'
Posted On2019-05-13