Incidental Mutation 'R7045:Olfr319'
ID547265
Institutional Source Beutler Lab
Gene Symbol Olfr319
Ensembl Gene ENSMUSG00000064044
Gene Nameolfactory receptor 319
SynonymsMOR285-2, GA_x6K02T2NKPP-708319-707399
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R7045 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location58699162-58703472 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) A to T at 58701669 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076965] [ENSMUST00000215962]
Predicted Effect probably benign
Transcript: ENSMUST00000076965
SMART Domains Protein: ENSMUSP00000076232
Gene: ENSMUSG00000064044

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 3.8e-46 PFAM
Pfam:7tm_1 41 290 1.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215962
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt1 A T 12: 112,662,301 Y18* probably null Het
Ank2 C A 3: 127,012,744 A583S probably damaging Het
Atp8b4 T C 2: 126,372,195 N706S probably benign Het
Bace2 A G 16: 97,399,665 N111S probably damaging Het
Cnp A T 11: 100,580,358 R275S probably benign Het
Cs T A 10: 128,352,717 M104K probably benign Het
Ctcfl G A 2: 173,112,374 T310I probably damaging Het
Cyp2d40 T C 15: 82,761,562 I81V probably benign Het
Ddx19a A G 8: 110,993,074 V30A probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dock6 G A 9: 21,821,811 A1062V probably damaging Het
Dpysl2 T C 14: 66,829,946 D172G probably benign Het
Eml2 A G 7: 19,201,579 D638G probably damaging Het
Epb41l4b C A 4: 57,103,522 A105S possibly damaging Het
Fam198a T C 9: 121,965,641 L287P probably damaging Het
Fat4 A G 3: 38,888,601 I548V probably benign Het
Gabrb2 G A 11: 42,593,931 A272T probably damaging Het
Hcn1 C T 13: 117,975,462 P654L unknown Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hk1 C A 10: 62,286,570 G477C probably damaging Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Kiss1r A G 10: 79,919,425 probably null Het
L3mbtl4 G T 17: 68,461,566 R223L probably benign Het
Loxl4 G T 19: 42,606,635 N200K probably damaging Het
Lrba T C 3: 86,285,091 V104A probably benign Het
Lyst T A 13: 13,634,900 V385D probably benign Het
Lyst T A 13: 13,637,708 C902S probably damaging Het
Mrpl28 T C 17: 26,126,287 F227S probably benign Het
Mtmr3 A T 11: 4,498,896 V289E possibly damaging Het
Ndst3 A G 3: 123,672,083 V80A probably damaging Het
Nid2 C T 14: 19,779,681 A680V possibly damaging Het
Nudcd1 T C 15: 44,405,830 N145D probably benign Het
Nup210 A T 6: 91,054,451 I812N probably damaging Het
Olfr1008 A G 2: 85,689,911 S161G possibly damaging Het
Olfr130 C T 17: 38,067,971 H267Y probably benign Het
Olfr1390 A T 11: 49,340,930 T133S probably damaging Het
Olfr1468-ps1 C A 19: 13,374,972 N3K probably damaging Het
Olfr251 T A 9: 38,378,433 M184K probably damaging Het
Olfr503 A G 7: 108,545,245 K238R probably damaging Het
Pcdhb6 A C 18: 37,336,276 Q750P possibly damaging Het
Plppr4 T C 3: 117,360,034 Y72C probably damaging Het
Rasgrf2 G T 13: 92,022,592 probably benign Het
Sbk2 A G 7: 4,958,906 I127T probably damaging Het
Smchd1 A C 17: 71,415,044 S817A probably benign Het
Speer4b A T 5: 27,500,125 N83K probably damaging Het
Strc A T 2: 121,370,726 L1296Q probably damaging Het
Svs1 T C 6: 48,988,612 V518A possibly damaging Het
Thap11 C A 8: 105,855,583 R75S possibly damaging Het
Unc13a A C 8: 71,658,763 L268R possibly damaging Het
Zfp39 A T 11: 58,890,443 C498S unknown Het
Zfp507 T C 7: 35,795,553 T22A possibly damaging Het
Zfp85 T C 13: 67,749,593 Y120C probably benign Het
Zfp882 G A 8: 71,913,249 probably null Het
Other mutations in Olfr319
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Olfr319 APN 11 58701767 missense probably benign
IGL01955:Olfr319 APN 11 58702129 missense probably damaging 0.97
IGL02145:Olfr319 APN 11 58702060 missense probably damaging 0.99
IGL02283:Olfr319 APN 11 58702276 missense probably damaging 0.96
R0468:Olfr319 UTSW 11 58701793 missense probably damaging 1.00
R0499:Olfr319 UTSW 11 58702243 missense probably benign 0.01
R0815:Olfr319 UTSW 11 58702609 missense possibly damaging 0.84
R0885:Olfr319 UTSW 11 58702087 missense possibly damaging 0.93
R1081:Olfr319 UTSW 11 58702498 missense probably damaging 1.00
R1603:Olfr319 UTSW 11 58702460 missense probably benign 0.00
R1935:Olfr319 UTSW 11 58702346 missense probably damaging 1.00
R1936:Olfr319 UTSW 11 58702346 missense probably damaging 1.00
R1938:Olfr319 UTSW 11 58702623 makesense probably null
R2436:Olfr319 UTSW 11 58702126 missense probably damaging 0.97
R4243:Olfr319 UTSW 11 58702451 missense probably damaging 1.00
R4244:Olfr319 UTSW 11 58702451 missense probably damaging 1.00
R4742:Olfr319 UTSW 11 58701859 missense probably benign
R4801:Olfr319 UTSW 11 58701791 missense probably benign
R4802:Olfr319 UTSW 11 58701791 missense probably benign
R4927:Olfr319 UTSW 11 58701807 missense probably damaging 1.00
R5259:Olfr319 UTSW 11 58701952 missense probably benign 0.07
R5259:Olfr319 UTSW 11 58701953 missense possibly damaging 0.83
R5393:Olfr319 UTSW 11 58702500 missense probably damaging 0.97
R5471:Olfr319 UTSW 11 58702325 missense probably damaging 0.98
R5571:Olfr319 UTSW 11 58702051 missense probably damaging 1.00
R6746:Olfr319 UTSW 11 58702543 missense probably benign
X0065:Olfr319 UTSW 11 58702489 missense probably benign 0.02
Z1177:Olfr319 UTSW 11 58702113 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GAGATCCCATGACTTAATGCATGC -3'
(R):5'- GAGGACCAGTGTGATGTTGC -3'

Sequencing Primer
(F):5'- ACATAAGCCTGACATTAGCATGTG -3'
(R):5'- ATGTTGCCTATGAGAGCCAC -3'
Posted On2019-05-13