Incidental Mutation 'R7045:Rasgrf2'
ID 547272
Institutional Source Beutler Lab
Gene Symbol Rasgrf2
Ensembl Gene ENSMUSG00000021708
Gene Name RAS protein-specific guanine nucleotide-releasing factor 2
Synonyms Grf2, 6330417G04Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.191) question?
Stock # R7045 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 92028519-92268164 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) G to T at 92159100 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099326] [ENSMUST00000216219]
AlphaFold P70392
Predicted Effect probably benign
Transcript: ENSMUST00000099326
SMART Domains Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708

DomainStartEndE-ValueType
PH 23 135 1.29e-16 SMART
IQ 204 226 1.3e0 SMART
RhoGEF 247 428 2.2e-51 SMART
RasGEFN 633 775 9.35e-15 SMART
RasGEFN 786 923 6.04e-9 SMART
RasGEF 949 1186 2.97e-112 SMART
Predicted Effect unknown
Transcript: ENSMUST00000216219
AA Change: N470K
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt1 A T 12: 112,628,735 (GRCm39) Y18* probably null Het
Ank2 C A 3: 126,806,393 (GRCm39) A583S probably damaging Het
Aoc1l3 T C 6: 48,965,546 (GRCm39) V518A possibly damaging Het
Atp8b4 T C 2: 126,214,115 (GRCm39) N706S probably benign Het
Bace2 A G 16: 97,200,865 (GRCm39) N111S probably damaging Het
Cnp A T 11: 100,471,184 (GRCm39) R275S probably benign Het
Cs T A 10: 128,188,586 (GRCm39) M104K probably benign Het
Ctcfl G A 2: 172,954,167 (GRCm39) T310I probably damaging Het
Cyp2d40 T C 15: 82,645,763 (GRCm39) I81V probably benign Het
Ddx19a A G 8: 111,719,706 (GRCm39) V30A probably benign Het
Disp1 C A 1: 182,869,030 (GRCm39) R1130L probably damaging Het
Dock6 G A 9: 21,733,107 (GRCm39) A1062V probably damaging Het
Dpysl2 T C 14: 67,067,395 (GRCm39) D172G probably benign Het
Eml2 A G 7: 18,935,504 (GRCm39) D638G probably damaging Het
Epb41l4b C A 4: 57,103,522 (GRCm39) A105S possibly damaging Het
Fat4 A G 3: 38,942,750 (GRCm39) I548V probably benign Het
Gabrb2 G A 11: 42,484,758 (GRCm39) A272T probably damaging Het
Gask1a T C 9: 121,794,707 (GRCm39) L287P probably damaging Het
Hcn1 C T 13: 118,111,998 (GRCm39) P654L unknown Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,194,000 (GRCm39) probably benign Het
Hk1 C A 10: 62,122,349 (GRCm39) G477C probably damaging Het
Hspa5 C T 2: 34,663,204 (GRCm39) P127L probably damaging Het
Kiss1r A G 10: 79,755,259 (GRCm39) probably null Het
L3mbtl4 G T 17: 68,768,561 (GRCm39) R223L probably benign Het
Loxl4 G T 19: 42,595,074 (GRCm39) N200K probably damaging Het
Lrba T C 3: 86,192,398 (GRCm39) V104A probably benign Het
Lyst T A 13: 13,809,485 (GRCm39) V385D probably benign Het
Lyst T A 13: 13,812,293 (GRCm39) C902S probably damaging Het
Mrpl28 T C 17: 26,345,261 (GRCm39) F227S probably benign Het
Mtmr3 A T 11: 4,448,896 (GRCm39) V289E possibly damaging Het
Ndst3 A G 3: 123,465,732 (GRCm39) V80A probably damaging Het
Nid2 C T 14: 19,829,749 (GRCm39) A680V possibly damaging Het
Nudcd1 T C 15: 44,269,226 (GRCm39) N145D probably benign Het
Nup210 A T 6: 91,031,433 (GRCm39) I812N probably damaging Het
Or2ak6 A T 11: 58,592,495 (GRCm39) probably benign Het
Or2g7 C T 17: 38,378,862 (GRCm39) H267Y probably benign Het
Or2y17 A T 11: 49,231,757 (GRCm39) T133S probably damaging Het
Or52n4b A G 7: 108,144,452 (GRCm39) K238R probably damaging Het
Or5b114-ps1 C A 19: 13,352,336 (GRCm39) N3K probably damaging Het
Or8c11 T A 9: 38,289,729 (GRCm39) M184K probably damaging Het
Or8k16 A G 2: 85,520,255 (GRCm39) S161G possibly damaging Het
Pcdhb6 A C 18: 37,469,329 (GRCm39) Q750P possibly damaging Het
Plppr4 T C 3: 117,153,683 (GRCm39) Y72C probably damaging Het
Sbk2 A G 7: 4,961,905 (GRCm39) I127T probably damaging Het
Smchd1 A C 17: 71,722,039 (GRCm39) S817A probably benign Het
Speer4b A T 5: 27,705,123 (GRCm39) N83K probably damaging Het
Strc A T 2: 121,201,207 (GRCm39) L1296Q probably damaging Het
Thap11 C A 8: 106,582,215 (GRCm39) R75S possibly damaging Het
Unc13a A C 8: 72,111,407 (GRCm39) L268R possibly damaging Het
Zfp39 A T 11: 58,781,269 (GRCm39) C498S unknown Het
Zfp507 T C 7: 35,494,978 (GRCm39) T22A possibly damaging Het
Zfp85 T C 13: 67,897,712 (GRCm39) Y120C probably benign Het
Zfp882 G A 8: 72,667,093 (GRCm39) probably null Het
Other mutations in Rasgrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rasgrf2 APN 13 92,159,425 (GRCm39) splice site probably benign
IGL01358:Rasgrf2 APN 13 92,130,749 (GRCm39) missense probably benign 0.23
IGL01666:Rasgrf2 APN 13 92,174,718 (GRCm39) missense probably damaging 1.00
IGL01930:Rasgrf2 APN 13 92,130,857 (GRCm39) missense probably damaging 0.98
IGL02230:Rasgrf2 APN 13 92,136,145 (GRCm39) missense probably damaging 1.00
IGL02630:Rasgrf2 APN 13 92,267,900 (GRCm39) missense probably damaging 1.00
IGL02690:Rasgrf2 APN 13 92,167,273 (GRCm39) missense probably damaging 1.00
IGL02943:Rasgrf2 APN 13 92,131,752 (GRCm39) missense probably damaging 1.00
IGL03067:Rasgrf2 APN 13 92,159,413 (GRCm39) missense probably damaging 0.97
IGL03342:Rasgrf2 APN 13 92,136,098 (GRCm39) missense probably damaging 1.00
IGL03405:Rasgrf2 APN 13 92,044,170 (GRCm39) missense probably damaging 1.00
R0620:Rasgrf2 UTSW 13 92,067,936 (GRCm39) splice site probably benign
R0632:Rasgrf2 UTSW 13 92,120,393 (GRCm39) missense probably benign 0.00
R0894:Rasgrf2 UTSW 13 92,130,890 (GRCm39) missense probably damaging 1.00
R1354:Rasgrf2 UTSW 13 92,165,174 (GRCm39) missense probably damaging 1.00
R1400:Rasgrf2 UTSW 13 92,035,808 (GRCm39) missense probably damaging 1.00
R1437:Rasgrf2 UTSW 13 92,167,396 (GRCm39) missense probably damaging 1.00
R1443:Rasgrf2 UTSW 13 92,131,795 (GRCm39) missense probably damaging 1.00
R1522:Rasgrf2 UTSW 13 92,044,205 (GRCm39) missense probably benign 0.00
R1553:Rasgrf2 UTSW 13 92,038,783 (GRCm39) missense probably damaging 1.00
R1613:Rasgrf2 UTSW 13 92,050,740 (GRCm39) missense probably damaging 1.00
R1883:Rasgrf2 UTSW 13 92,117,149 (GRCm39) missense probably benign
R1934:Rasgrf2 UTSW 13 92,131,825 (GRCm39) splice site probably null
R1990:Rasgrf2 UTSW 13 92,172,473 (GRCm39) missense probably damaging 1.00
R2037:Rasgrf2 UTSW 13 92,050,748 (GRCm39) missense probably damaging 0.99
R2043:Rasgrf2 UTSW 13 92,167,351 (GRCm39) missense possibly damaging 0.91
R2135:Rasgrf2 UTSW 13 92,120,374 (GRCm39) missense probably benign
R2193:Rasgrf2 UTSW 13 92,160,221 (GRCm39) splice site probably null
R2406:Rasgrf2 UTSW 13 92,120,359 (GRCm39) missense probably benign
R3055:Rasgrf2 UTSW 13 92,165,583 (GRCm39) missense probably damaging 1.00
R3916:Rasgrf2 UTSW 13 92,167,296 (GRCm39) missense probably damaging 1.00
R3954:Rasgrf2 UTSW 13 92,130,974 (GRCm39) missense probably damaging 0.98
R3955:Rasgrf2 UTSW 13 92,130,974 (GRCm39) missense probably damaging 0.98
R3956:Rasgrf2 UTSW 13 92,130,974 (GRCm39) missense probably damaging 0.98
R4133:Rasgrf2 UTSW 13 92,130,773 (GRCm39) missense possibly damaging 0.59
R4177:Rasgrf2 UTSW 13 92,038,717 (GRCm39) missense probably damaging 1.00
R4178:Rasgrf2 UTSW 13 92,038,717 (GRCm39) missense probably damaging 1.00
R4357:Rasgrf2 UTSW 13 92,038,796 (GRCm39) missense probably damaging 1.00
R4358:Rasgrf2 UTSW 13 92,038,796 (GRCm39) missense probably damaging 1.00
R4359:Rasgrf2 UTSW 13 92,038,796 (GRCm39) missense probably damaging 1.00
R4439:Rasgrf2 UTSW 13 92,131,797 (GRCm39) missense possibly damaging 0.95
R4440:Rasgrf2 UTSW 13 92,131,797 (GRCm39) missense possibly damaging 0.95
R4441:Rasgrf2 UTSW 13 92,131,797 (GRCm39) missense possibly damaging 0.95
R4564:Rasgrf2 UTSW 13 92,033,773 (GRCm39) nonsense probably null
R4576:Rasgrf2 UTSW 13 92,044,529 (GRCm39) missense possibly damaging 0.58
R4590:Rasgrf2 UTSW 13 92,174,789 (GRCm39) missense probably damaging 1.00
R4718:Rasgrf2 UTSW 13 92,138,716 (GRCm39) critical splice donor site probably null
R4778:Rasgrf2 UTSW 13 92,131,780 (GRCm39) missense probably damaging 0.99
R4790:Rasgrf2 UTSW 13 92,136,135 (GRCm39) missense probably damaging 1.00
R4808:Rasgrf2 UTSW 13 92,160,190 (GRCm39) missense probably damaging 1.00
R5151:Rasgrf2 UTSW 13 92,044,155 (GRCm39) missense probably damaging 1.00
R5286:Rasgrf2 UTSW 13 92,267,941 (GRCm39) missense possibly damaging 0.94
R5902:Rasgrf2 UTSW 13 92,068,011 (GRCm39) missense probably damaging 1.00
R6180:Rasgrf2 UTSW 13 92,165,609 (GRCm39) missense probably damaging 1.00
R6264:Rasgrf2 UTSW 13 92,167,293 (GRCm39) missense probably damaging 1.00
R6369:Rasgrf2 UTSW 13 92,267,954 (GRCm39) missense probably benign
R6428:Rasgrf2 UTSW 13 92,136,100 (GRCm39) missense probably damaging 1.00
R6595:Rasgrf2 UTSW 13 92,167,361 (GRCm39) missense probably damaging 1.00
R6619:Rasgrf2 UTSW 13 92,165,027 (GRCm39) missense probably damaging 1.00
R6988:Rasgrf2 UTSW 13 92,033,754 (GRCm39) missense probably benign 0.02
R7026:Rasgrf2 UTSW 13 92,131,732 (GRCm39) missense probably damaging 1.00
R7038:Rasgrf2 UTSW 13 92,130,952 (GRCm39) missense possibly damaging 0.95
R7056:Rasgrf2 UTSW 13 92,167,203 (GRCm39) missense probably damaging 0.99
R7058:Rasgrf2 UTSW 13 92,034,521 (GRCm39) missense probably damaging 0.99
R7256:Rasgrf2 UTSW 13 92,032,637 (GRCm39) nonsense probably null
R7392:Rasgrf2 UTSW 13 92,041,856 (GRCm39) missense
R7469:Rasgrf2 UTSW 13 92,165,530 (GRCm39) critical splice donor site probably null
R7618:Rasgrf2 UTSW 13 92,136,085 (GRCm39) missense
R7641:Rasgrf2 UTSW 13 92,267,914 (GRCm39) missense possibly damaging 0.65
R7674:Rasgrf2 UTSW 13 92,267,914 (GRCm39) missense possibly damaging 0.65
R7784:Rasgrf2 UTSW 13 92,044,201 (GRCm39) missense
R7962:Rasgrf2 UTSW 13 92,167,300 (GRCm39) missense probably damaging 0.99
R8056:Rasgrf2 UTSW 13 92,167,321 (GRCm39) missense probably damaging 0.97
R8218:Rasgrf2 UTSW 13 92,130,796 (GRCm39) missense
R8796:Rasgrf2 UTSW 13 92,038,685 (GRCm39) missense
R8913:Rasgrf2 UTSW 13 92,159,034 (GRCm39) missense probably benign 0.05
R8971:Rasgrf2 UTSW 13 92,158,225 (GRCm39) missense possibly damaging 0.80
R9020:Rasgrf2 UTSW 13 92,165,146 (GRCm39) missense possibly damaging 0.93
R9487:Rasgrf2 UTSW 13 92,267,759 (GRCm39) missense probably benign
R9562:Rasgrf2 UTSW 13 92,034,469 (GRCm39) critical splice donor site probably null
R9712:Rasgrf2 UTSW 13 92,136,092 (GRCm39) missense
R9766:Rasgrf2 UTSW 13 92,160,188 (GRCm39) missense probably damaging 1.00
R9800:Rasgrf2 UTSW 13 92,267,860 (GRCm39) missense probably damaging 0.99
X0013:Rasgrf2 UTSW 13 92,167,363 (GRCm39) missense probably damaging 1.00
X0026:Rasgrf2 UTSW 13 92,050,654 (GRCm39) missense probably damaging 0.99
Z1177:Rasgrf2 UTSW 13 92,159,081 (GRCm39) missense unknown
Z1177:Rasgrf2 UTSW 13 92,131,632 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AGTGCCACTTTCTCGTGAGC -3'
(R):5'- GGACACCAGCCAAACTTTTATC -3'

Sequencing Primer
(F):5'- GTGAGCCTTTGCCTGGATATCATC -3'
(R):5'- CTTTTATCCGACAAGGTAAGACTGGC -3'
Posted On 2019-05-13