Incidental Mutation 'R0611:Unc13a'
ID54730
Institutional Source Beutler Lab
Gene Symbol Unc13a
Ensembl Gene ENSMUSG00000034799
Gene Nameunc-13 homolog A (C. elegans)
Synonyms2410078G03Rik, Munc13-1
MMRRC Submission 038800-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0611 (G1)
Quality Score219
Status Not validated
Chromosome8
Chromosomal Location71624417-71671757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71649865 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 958 (S958P)
Ref Sequence ENSEMBL: ENSMUSP00000030170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030170] [ENSMUST00000177517]
Predicted Effect probably damaging
Transcript: ENSMUST00000030170
AA Change: S958P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030170
Gene: ENSMUSG00000034799
AA Change: S958P

DomainStartEndE-ValueType
C2 3 94 5.23e-10 SMART
low complexity region 187 202 N/A INTRINSIC
low complexity region 264 277 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
coiled coil region 321 359 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 435 450 N/A INTRINSIC
PDB:2KDU|B 454 488 3e-16 PDB
C1 563 612 3.93e-18 SMART
C2 686 793 5.86e-22 SMART
DUF1041 1002 1111 1.6e-56 SMART
Pfam:Membr_traf_MHD 1355 1520 6.3e-53 PFAM
C2 1555 1661 5.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176127
Predicted Effect probably benign
Transcript: ENSMUST00000176426
Predicted Effect probably damaging
Transcript: ENSMUST00000177517
AA Change: S958P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135189
Gene: ENSMUSG00000034799
AA Change: S958P

DomainStartEndE-ValueType
C2 3 94 5.23e-10 SMART
low complexity region 187 202 N/A INTRINSIC
low complexity region 264 277 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
coiled coil region 321 359 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 435 450 N/A INTRINSIC
PDB:2KDU|B 454 488 3e-16 PDB
C1 563 612 3.93e-18 SMART
C2 686 793 5.86e-22 SMART
DUF1041 1002 1111 1.6e-56 SMART
Pfam:Membr_traf_MHD 1355 1520 6.7e-53 PFAM
C2 1574 1680 5.03e-12 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UNC13 family. UNC13 proteins bind to phorbol esters and diacylglycerol and play important roles in neurotransmitter release at synapses. Single nucleotide polymorphisms in this gene may be associated with sporadic amyotrophic lateral sclerosis. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutant mice do not feed and die within hours of birth and synaptic vesicle maturation is impaired. Mice homozygous for a knock-in allele exhibit slower rate of synaptic vesicle replenishment, aberrant short-term depression and reduced recoveryfrom synaptic depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 120,252,256 M819K possibly damaging Het
Adamtsl3 T G 7: 82,528,912 C528G probably damaging Het
Akap9 A G 5: 3,954,870 K148E probably benign Het
Akr1b3 A T 6: 34,309,642 D225E probably benign Het
Alms1 C A 6: 85,678,671 Q2931K possibly damaging Het
Ano3 T C 2: 110,885,001 K31E possibly damaging Het
Cdc37 A G 9: 21,142,241 I242T probably damaging Het
Celsr1 T A 15: 85,932,323 K1806N possibly damaging Het
Clpb T A 7: 101,787,749 I707N possibly damaging Het
Cntnap2 A T 6: 47,095,549 Y1017F possibly damaging Het
Creb3l2 A T 6: 37,334,481 S458T probably benign Het
Ctnnd2 C A 15: 31,009,084 T1109K possibly damaging Het
Dcaf10 T A 4: 45,373,011 L425Q probably damaging Het
Dlec1 A G 9: 119,112,099 E239G probably benign Het
Dnah2 T C 11: 69,499,194 K742E probably damaging Het
Dsp A T 13: 38,187,741 R889S probably damaging Het
Dync1h1 T A 12: 110,632,788 M1859K probably damaging Het
Efcab7 T A 4: 99,901,689 N361K probably damaging Het
Eps8l2 T C 7: 141,355,733 V139A probably damaging Het
Fads3 T G 19: 10,041,836 H35Q probably damaging Het
Fam163b C A 2: 27,113,571 V24F probably damaging Het
Gm14496 A T 2: 181,995,111 T121S probably benign Het
Gm4799 C T 10: 82,954,729 noncoding transcript Het
Gm7168 A T 17: 13,949,535 D388V probably benign Het
Gmeb1 A T 4: 132,226,075 L460* probably null Het
Gpc6 T G 14: 117,975,018 F534V probably null Het
Hectd3 A G 4: 116,996,044 D156G possibly damaging Het
Itga6 T C 2: 71,820,060 I150T possibly damaging Het
Kansl1 A G 11: 104,338,186 M863T probably benign Het
Kcnb2 A T 1: 15,710,440 Y512F probably benign Het
Klhdc2 A T 12: 69,300,279 M73L probably benign Het
Ktn1 A G 14: 47,694,616 T667A probably benign Het
Lgsn A C 1: 31,203,655 I273L probably benign Het
Lilra5 A G 7: 4,242,233 D292G probably benign Het
Mrps27 C T 13: 99,405,074 R229C probably damaging Het
Muc5b T G 7: 141,862,436 S3040A probably benign Het
Nat14 T C 7: 4,923,276 S7P probably damaging Het
Nfia A G 4: 97,783,457 I135V possibly damaging Het
Nkd1 G A 8: 88,522,316 A30T probably damaging Het
Nup205 A G 6: 35,225,968 D1370G probably null Het
Olfr282 T C 15: 98,438,287 S273P possibly damaging Het
Olfr344 C G 2: 36,569,556 probably null Het
Olfr507 T A 7: 108,622,287 N158K possibly damaging Het
Olfr633 T C 7: 103,947,193 L209P probably damaging Het
Olfr726 G A 14: 50,083,853 T276I probably damaging Het
Orc1 C T 4: 108,602,032 A466V probably benign Het
Otud7a T A 7: 63,735,890 D367E possibly damaging Het
Pcdhb4 A G 18: 37,308,210 Y191C probably damaging Het
Pclo T C 5: 14,678,775 probably benign Het
Pclo T C 5: 14,712,814 V3767A unknown Het
Prmt1 A T 7: 44,978,801 probably null Het
Ralgapa1 A G 12: 55,795,698 F62S probably damaging Het
Rangrf T C 11: 68,972,692 S163G probably benign Het
Rgs12 C A 5: 35,019,460 A65E probably damaging Het
Rrbp1 T C 2: 143,988,516 N577S probably damaging Het
Sept11 A G 5: 93,167,534 H374R probably damaging Het
Serpina5 T G 12: 104,103,787 N314K probably benign Het
Sgce T C 6: 4,689,621 D395G probably damaging Het
Slc26a9 A T 1: 131,762,761 N501I probably damaging Het
Slc9c1 A G 16: 45,581,602 D784G possibly damaging Het
Snapc2 A G 8: 4,255,676 D207G probably benign Het
Stard9 G T 2: 120,699,257 M1998I probably benign Het
Stk38 A C 17: 28,975,933 F280V possibly damaging Het
Tas2r126 A G 6: 42,435,091 K186R probably damaging Het
Tdp1 A C 12: 99,909,711 D307A probably benign Het
Tead2 A G 7: 45,217,250 D11G probably damaging Het
Tmco4 C A 4: 139,020,072 L211I probably damaging Het
Tmem183a A G 1: 134,352,377 F255S probably damaging Het
Tmem87a C T 2: 120,375,448 G349S possibly damaging Het
Tpte G A 8: 22,336,533 E377K possibly damaging Het
Trim32 T C 4: 65,613,656 F150S possibly damaging Het
Trpc7 T A 13: 56,887,823 K99M probably damaging Het
Ttc22 A G 4: 106,634,184 K195E probably damaging Het
Txn2 G A 15: 77,927,717 P7S probably damaging Het
Ubxn2a G A 12: 4,880,700 T220I probably damaging Het
Ufd1 A G 16: 18,814,876 N17S possibly damaging Het
Vmn1r202 T A 13: 22,501,654 M198L probably damaging Het
Vmn2r84 G A 10: 130,386,122 A743V probably damaging Het
Washc5 A G 15: 59,341,158 F891S probably damaging Het
Zfp708 T C 13: 67,070,311 T495A probably benign Het
Zfp81 A G 17: 33,334,619 I407T probably benign Het
Zswim5 T C 4: 116,986,677 probably null Het
Other mutations in Unc13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Unc13a APN 8 71643147 missense probably null 0.70
IGL01023:Unc13a APN 8 71661825 missense probably benign 0.02
IGL01456:Unc13a APN 8 71644567 missense probably damaging 1.00
IGL01820:Unc13a APN 8 71654947 missense probably damaging 0.99
IGL01909:Unc13a APN 8 71639210 splice site probably benign
IGL01925:Unc13a APN 8 71634543 missense possibly damaging 0.95
IGL02407:Unc13a APN 8 71648942 missense probably damaging 0.99
IGL02622:Unc13a APN 8 71652514 splice site probably null
IGL02634:Unc13a APN 8 71655701 missense probably benign 0.03
IGL02724:Unc13a APN 8 71656305 splice site probably benign
IGL02892:Unc13a APN 8 71649910 missense probably damaging 1.00
IGL02948:Unc13a APN 8 71650549 missense possibly damaging 0.63
IGL03081:Unc13a APN 8 71649549 missense probably damaging 0.98
IGL03372:Unc13a APN 8 71655709 missense probably damaging 1.00
curvy UTSW 8 71630504 splice site probably null
Greed UTSW 8 71654845 missense probably damaging 1.00
largesse UTSW 8 71634658 missense probably damaging 1.00
serpiginous UTSW 8 71664245 missense probably damaging 1.00
PIT4469001:Unc13a UTSW 8 71658314 nonsense probably null
R0067:Unc13a UTSW 8 71634658 missense probably damaging 1.00
R0067:Unc13a UTSW 8 71634658 missense probably damaging 1.00
R0389:Unc13a UTSW 8 71658032 missense probably benign 0.01
R0457:Unc13a UTSW 8 71658001 critical splice donor site probably null
R0478:Unc13a UTSW 8 71651148 missense possibly damaging 0.92
R0483:Unc13a UTSW 8 71644913 missense probably damaging 0.96
R0609:Unc13a UTSW 8 71658467 missense probably damaging 0.96
R0730:Unc13a UTSW 8 71656285 missense possibly damaging 0.68
R0883:Unc13a UTSW 8 71642173 nonsense probably null
R1162:Unc13a UTSW 8 71647917 missense probably benign 0.31
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1196:Unc13a UTSW 8 71654986 missense probably damaging 1.00
R1400:Unc13a UTSW 8 71651221 missense probably damaging 1.00
R1446:Unc13a UTSW 8 71648981 missense possibly damaging 0.91
R1507:Unc13a UTSW 8 71658266 missense probably benign
R1636:Unc13a UTSW 8 71653390 missense probably damaging 1.00
R1858:Unc13a UTSW 8 71652399 missense probably damaging 1.00
R2025:Unc13a UTSW 8 71639768 missense possibly damaging 0.92
R2107:Unc13a UTSW 8 71656251 splice site probably null
R2286:Unc13a UTSW 8 71630559 missense probably damaging 1.00
R2334:Unc13a UTSW 8 71634558 missense probably damaging 1.00
R2924:Unc13a UTSW 8 71644952 missense possibly damaging 0.88
R3177:Unc13a UTSW 8 71629695 missense probably benign 0.01
R3277:Unc13a UTSW 8 71629695 missense probably benign 0.01
R4175:Unc13a UTSW 8 71667724 intron probably benign
R4279:Unc13a UTSW 8 71666667 missense probably damaging 0.98
R4629:Unc13a UTSW 8 71653453 missense possibly damaging 0.65
R4803:Unc13a UTSW 8 71662850 splice site probably null
R4877:Unc13a UTSW 8 71658616 missense possibly damaging 0.85
R4927:Unc13a UTSW 8 71654845 missense probably damaging 1.00
R4930:Unc13a UTSW 8 71630504 splice site probably null
R4994:Unc13a UTSW 8 71643172 missense probably benign 0.28
R5011:Unc13a UTSW 8 71641477 nonsense probably null
R5252:Unc13a UTSW 8 71652564 missense probably damaging 1.00
R5356:Unc13a UTSW 8 71662514 missense probably benign 0.02
R5458:Unc13a UTSW 8 71664245 missense probably damaging 1.00
R5514:Unc13a UTSW 8 71643151 missense probably damaging 1.00
R5784:Unc13a UTSW 8 71655666 missense possibly damaging 0.61
R5853:Unc13a UTSW 8 71655129 splice site probably null
R6183:Unc13a UTSW 8 71644666 missense probably damaging 1.00
R6277:Unc13a UTSW 8 71666639 critical splice donor site probably null
R6374:Unc13a UTSW 8 71641453 missense possibly damaging 0.70
R6392:Unc13a UTSW 8 71637809 missense possibly damaging 0.83
R6515:Unc13a UTSW 8 71647940 missense probably benign 0.44
R6576:Unc13a UTSW 8 71653478 missense probably benign 0.00
R6943:Unc13a UTSW 8 71652377 missense probably damaging 1.00
R7045:Unc13a UTSW 8 71658763 missense possibly damaging 0.95
R7062:Unc13a UTSW 8 71663237 missense probably benign 0.00
R7146:Unc13a UTSW 8 71630553 missense probably damaging 1.00
R7260:Unc13a UTSW 8 71660585 missense possibly damaging 0.71
R7443:Unc13a UTSW 8 71630959 missense probably damaging 0.98
R7545:Unc13a UTSW 8 71641509 critical splice acceptor site probably null
R7644:Unc13a UTSW 8 71634538 missense probably benign 0.13
R7780:Unc13a UTSW 8 71658335 missense probably benign 0.02
Z1088:Unc13a UTSW 8 71654803 critical splice donor site probably null
Z1177:Unc13a UTSW 8 71644872 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTCAGGCCACGAGGTTTCTTCAC -3'
(R):5'- TACTGGGTTCTATCTGCACCGCAC -3'

Sequencing Primer
(F):5'- ACCGTGGACTTGAGATCCTG -3'
(R):5'- taggaggctgaggcagg -3'
Posted On2013-07-11