Mutagenetix > Incidental Mutations

Incidental Mutation 'R7046:Plxna4'

547308

Institutional Source

Beutler Lab

Gene Symbol

Plxna4

Ensembl Gene

ENSMUSG00000029765

Gene Name

plexin A4

Synonyms

Plxa4

MMRRC Submission

Accession Numbers

Genbank: NM_175750

Is this an essential gene?

Possibly essential (E-score: 0.738) question?

Stock #

R7046 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

32144268-32588192 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 32516505 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 392 (C392Y)

Ref Sequence

ENSEMBL: ENSMUSP00000110748 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115096]

AlphaFold

Q80UG2

Predicted Effect

probably damaging
Transcript: ENSMUST00000115096
AA Change: C392Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110748
Gene: ENSMUSG00000029765
AA Change: C392Y

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	50	490	2.3e-131	SMART
PSI	508	558	2.21e-14	SMART
PSI	654	701	2.44e-7	SMART
PSI	802	855	1.2e-6	SMART
IPT	856	950	7.25e-16	SMART
IPT	952	1036	4.1e-15	SMART
IPT	1038	1138	2.86e-14	SMART
IPT	1140	1229	6.88e-1	SMART
transmembrane domain	1237	1259	N/A	INTRINSIC
Pfam:Plexin_cytopl	1310	1863	1.8e-264	PFAM

Meta Mutation Damage Score

0.8752

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (63/63)

MGI Phenotype

PHENOTYPE: Homozygous null mice exhibit defective trajecotory and projection of peripheral sensory axons and sympathetic ganglion axons and the formation of the anterior commissure and the barrels. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc8	T	C	7: 46,122,940	Y805C	probably damaging	Het
Cabp7	T	A	11: 4,738,886	I195F	probably damaging	Het
Camsap1	T	C	2: 25,945,189	N317S	probably damaging	Het
Ccdc127	T	G	13: 74,352,875	L4V	probably damaging	Het
Ccdc7a	T	C	8: 129,047,619	E145G	probably damaging	Het
Cdh10	T	A	15: 19,013,201	V629D	probably damaging	Het
Cdh23	A	C	10: 60,378,751	L1497R	probably damaging	Het
Chsy3	A	G	18: 59,409,803	K671R	probably benign	Het
Clca4b	T	C	3: 144,915,606	Y569C	probably damaging	Het
Cnga1	T	C	5: 72,629,353		probably benign	Het
Cyp51	T	A	5: 4,100,188	E178D	probably damaging	Het
Defa30	T	A	8: 21,135,455	N78K	probably benign	Het
Disp1	C	A	1: 183,087,466	R1130L	probably damaging	Het
Dnah14	G	T	1: 181,623,003	C727F	probably benign	Het
Egf	A	T	3: 129,754,958	W3R	unknown	Het
Egfem1	G	A	3: 29,082,215		probably null	Het
Epb41l1	G	T	2: 156,526,892	V682L	possibly damaging	Het
Etv1	A	G	12: 38,784,370		probably null	Het
Faap100	A	G	11: 120,377,374	F191S	possibly damaging	Het
Fam208a	A	T	14: 27,472,435	L1197F	probably damaging	Het
Fmo1	T	A	1: 162,839,694	D184V	possibly damaging	Het
Ghrl	A	G	6: 113,719,383	L16P	probably damaging	Het
Gria4	T	A	9: 4,420,278	L861F	probably damaging	Het
Gsr	T	A	8: 33,695,062	M428K	probably damaging	Het
Hspa5	C	T	2: 34,773,192	P127L	probably damaging	Het
Kbtbd12	A	G	6: 88,618,515	M111T	possibly damaging	Het
Krtap21-1	G	T	16: 89,403,735	Y6*	probably null	Het
Lin9	A	G	1: 180,667,370	D219G	probably damaging	Het
Lrrc38	A	G	4: 143,350,169	M1V	probably null	Het
Macc1	T	G	12: 119,447,038	F514V	probably benign	Het
Madcam1	C	T	10: 79,668,305	R242C	probably benign	Het
Mfhas1	T	C	8: 35,664,790	S1037P	probably benign	Het
Micall2	C	T	5: 139,708,944		probably benign	Het
Mtr	C	A	13: 12,190,209	A1122S	possibly damaging	Het
Muc6	T	A	7: 141,640,189		probably benign	Het
Myh15	T	A	16: 49,109,299	C529*	probably null	Het
Napsa	T	C	7: 44,585,085	V247A	probably damaging	Het
Nr2c2	A	G	6: 92,158,357	T309A	probably damaging	Het
Olfr133	A	T	17: 38,148,800	M71L	probably benign	Het
Olfr357	T	A	2: 36,997,161	V117E	probably benign	Het
Olfr385	A	T	11: 73,589,732	I2K	probably benign	Het
Osgepl1	A	T	1: 53,321,551	I384F	possibly damaging	Het
Otud4	C	T	8: 79,651,042	L111F	possibly damaging	Het
Pds5b	A	G	5: 150,749,920	Y481C	probably damaging	Het
Pdzrn4	T	A	15: 92,770,422	Y818*	probably null	Het
Pin1rt1	T	C	2: 104,714,422	S122G	probably benign	Het
Pkdcc	A	T	17: 83,224,258	Y487F	probably damaging	Het
Psd4	T	G	2: 24,394,973	M283R	probably benign	Het
Ralgds	G	T	2: 28,540,729	G68W	probably damaging	Het
Rmdn2	T	A	17: 79,621,379	I20N	probably damaging	Het
Sestd1	A	G	2: 77,192,566	V486A	probably benign	Het
Svs1	T	A	6: 48,987,578	D173E	probably benign	Het
Tango6	A	G	8: 106,807,116	H958R	possibly damaging	Het
Taok3	C	T	5: 117,273,706	R857C	probably damaging	Het
Theg	G	T	10: 79,586,962	D35E	probably benign	Het
Trio	T	C	15: 27,832,051	E1245G	probably damaging	Het
Usp19	C	T	9: 108,497,135	H763Y	possibly damaging	Het
Vmn1r185	A	G	7: 26,611,226	S285P	probably damaging	Het
Vmn1r45	T	G	6: 89,933,556	Y144S	probably benign	Het
Vwa3b	G	A	1: 37,173,878	E152K	probably benign	Het
Wdr61	T	A	9: 54,719,255	D275V	probably damaging	Het
Xrcc5	G	A	1: 72,394,716	M731I	probably benign	Het
Zfp619	G	A	7: 39,537,363	S939N	possibly damaging	Het
Zfp874a	C	A	13: 67,442,299	C422F	probably damaging	Het
Zfp948	A	G	17: 21,588,457	D637G	possibly damaging	Het

Other mutations in Plxna4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Plxna4	APN	6	32162091	missense	probably damaging	1.00
IGL01395:Plxna4	APN	6	32239433	missense	probably damaging	0.99
IGL01506:Plxna4	APN	6	32516535	missense	probably damaging	1.00
IGL01606:Plxna4	APN	6	32158001	missense	probably damaging	1.00
IGL01753:Plxna4	APN	6	32310478	missense	probably benign	0.06
IGL01767:Plxna4	APN	6	32237678	missense	possibly damaging	0.51
IGL01968:Plxna4	APN	6	32215204	missense	possibly damaging	0.81
IGL02109:Plxna4	APN	6	32215641	missense	probably benign
IGL02299:Plxna4	APN	6	32165156	missense	probably benign	0.01
IGL02306:Plxna4	APN	6	32206124	missense	probably benign	0.19
IGL02312:Plxna4	APN	6	32165117	missense	possibly damaging	0.79
IGL02326:Plxna4	APN	6	32152905	missense	probably damaging	0.99
IGL02658:Plxna4	APN	6	32185411	missense	probably damaging	1.00
IGL02683:Plxna4	APN	6	32517606	missense	probably benign	0.03
IGL02701:Plxna4	APN	6	32517559	missense	probably benign	0.01
IGL02995:Plxna4	APN	6	32516595	missense	probably damaging	1.00
IGL03030:Plxna4	APN	6	32202225	missense	probably benign	0.01
IGL03264:Plxna4	APN	6	32178402	missense	possibly damaging	0.64
IGL03304:Plxna4	APN	6	32165051	splice site	probably benign
IGL03382:Plxna4	APN	6	32202194	missense	probably benign	0.23
corona	UTSW	6	32517264	missense	probably damaging	1.00
Disposed	UTSW	6	32516505	missense	probably damaging	1.00
inclined	UTSW	6	32237723	nonsense	probably null
Slope	UTSW	6	32234606	missense	probably benign	0.00
G4846:Plxna4	UTSW	6	32192272	missense	probably damaging	1.00
R0133:Plxna4	UTSW	6	32197074	missense	probably benign	0.00
R0200:Plxna4	UTSW	6	32197088	missense	probably damaging	0.99
R0308:Plxna4	UTSW	6	32237768	missense	probably benign	0.01
R0468:Plxna4	UTSW	6	32215246	missense	probably damaging	1.00
R0505:Plxna4	UTSW	6	32202119	missense	probably benign
R0542:Plxna4	UTSW	6	32192297	missense	probably damaging	1.00
R0548:Plxna4	UTSW	6	32158015	missense	probably damaging	1.00
R0652:Plxna4	UTSW	6	32185501	missense	probably damaging	1.00
R1144:Plxna4	UTSW	6	32197156	missense	possibly damaging	0.58
R1190:Plxna4	UTSW	6	32251136	missense	probably damaging	1.00
R1228:Plxna4	UTSW	6	32224152	splice site	probably null
R1569:Plxna4	UTSW	6	32185475	missense	possibly damaging	0.78
R1803:Plxna4	UTSW	6	32517444	missense	probably damaging	0.98
R1832:Plxna4	UTSW	6	32197826	missense	probably benign	0.01
R2068:Plxna4	UTSW	6	32517616	missense	possibly damaging	0.66
R2157:Plxna4	UTSW	6	32516974	missense	probably benign	0.00
R2842:Plxna4	UTSW	6	32215631	critical splice donor site	probably null
R2849:Plxna4	UTSW	6	32185532	missense	probably damaging	1.00
R2892:Plxna4	UTSW	6	32517037	missense	probably damaging	1.00
R2930:Plxna4	UTSW	6	32165780	missense	probably damaging	1.00
R3892:Plxna4	UTSW	6	32215654	missense	probably damaging	1.00
R4065:Plxna4	UTSW	6	32236365	nonsense	probably null
R4276:Plxna4	UTSW	6	32200948	missense	probably benign	0.29
R4307:Plxna4	UTSW	6	32163509	missense	probably damaging	0.99
R4331:Plxna4	UTSW	6	32150545	nonsense	probably null
R4478:Plxna4	UTSW	6	32196133	missense	possibly damaging	0.89
R4529:Plxna4	UTSW	6	32496896	critical splice acceptor site	probably null
R4566:Plxna4	UTSW	6	32517403	missense	probably benign	0.00
R4568:Plxna4	UTSW	6	32152938	missense	probably damaging	1.00
R4664:Plxna4	UTSW	6	32516950	missense	possibly damaging	0.88
R4685:Plxna4	UTSW	6	32165844	missense	probably damaging	1.00
R4701:Plxna4	UTSW	6	32516688	missense	probably damaging	0.99
R4939:Plxna4	UTSW	6	32165762	missense	probably damaging	1.00
R5153:Plxna4	UTSW	6	32224159	splice site	probably null
R5181:Plxna4	UTSW	6	32516997	missense	probably damaging	1.00
R5256:Plxna4	UTSW	6	32251072	missense	probably benign	0.03
R5259:Plxna4	UTSW	6	32517021	missense	possibly damaging	0.89
R5306:Plxna4	UTSW	6	32206121	missense	probably damaging	0.99
R5487:Plxna4	UTSW	6	32517283	missense	probably damaging	1.00
R5510:Plxna4	UTSW	6	32178358	missense	probably damaging	0.96
R5542:Plxna4	UTSW	6	32206230	missense	probably damaging	1.00
R5567:Plxna4	UTSW	6	32157980	missense	possibly damaging	0.61
R5634:Plxna4	UTSW	6	32237723	nonsense	probably null
R5653:Plxna4	UTSW	6	32517616	missense	possibly damaging	0.66
R5665:Plxna4	UTSW	6	32215722	missense	probably damaging	1.00
R5845:Plxna4	UTSW	6	32237776	missense	probably damaging	1.00
R5909:Plxna4	UTSW	6	32517246	missense	probably damaging	1.00
R5938:Plxna4	UTSW	6	32234606	missense	probably benign	0.00
R5973:Plxna4	UTSW	6	32251065	splice site	probably null
R6433:Plxna4	UTSW	6	32215678	missense	probably damaging	0.97
R6482:Plxna4	UTSW	6	32516737	missense	probably benign
R6560:Plxna4	UTSW	6	32215678	missense	probably damaging	0.97
R6721:Plxna4	UTSW	6	32200859	missense	probably benign	0.26
R6810:Plxna4	UTSW	6	32310522	missense	probably benign	0.18
R6985:Plxna4	UTSW	6	32237708	missense	probably damaging	1.00
R7024:Plxna4	UTSW	6	32192269	missense	probably damaging	1.00
R7137:Plxna4	UTSW	6	32517264	missense	probably damaging	1.00
R7163:Plxna4	UTSW	6	32496756	missense	probably benign	0.01
R7199:Plxna4	UTSW	6	32215178	nonsense	probably null
R7248:Plxna4	UTSW	6	32162160	missense	probably damaging	0.99
R7260:Plxna4	UTSW	6	32239520	missense	possibly damaging	0.79
R7361:Plxna4	UTSW	6	32196122	critical splice donor site	probably null
R7383:Plxna4	UTSW	6	32152799	critical splice donor site	probably null
R7405:Plxna4	UTSW	6	32196319	missense	probably benign	0.00
R7516:Plxna4	UTSW	6	32237768	missense	probably benign	0.00
R7635:Plxna4	UTSW	6	32496741	missense	probably damaging	0.98
R7754:Plxna4	UTSW	6	32152872	missense	probably damaging	1.00
R7763:Plxna4	UTSW	6	32223980	missense	probably damaging	0.99
R7789:Plxna4	UTSW	6	32206233	critical splice acceptor site	probably null
R8167:Plxna4	UTSW	6	32517046	missense	probably damaging	0.99
R8191:Plxna4	UTSW	6	32516950	missense	possibly damaging	0.88
R8225:Plxna4	UTSW	6	32162103	missense	probably damaging	1.00
R8284:Plxna4	UTSW	6	32152854	missense	probably benign	0.25
R8305:Plxna4	UTSW	6	32211065	missense	possibly damaging	0.81
R8438:Plxna4	UTSW	6	32202180	missense	probably damaging	1.00
R8493:Plxna4	UTSW	6	32215712	missense	probably benign	0.27
R8714:Plxna4	UTSW	6	32163444	nonsense	probably null
R8759:Plxna4	UTSW	6	32192341	missense	probably damaging	1.00
R8822:Plxna4	UTSW	6	32150496	missense	possibly damaging	0.89
R8844:Plxna4	UTSW	6	32197091	missense	probably benign	0.11
R8974:Plxna4	UTSW	6	32239512	missense	possibly damaging	0.79
R9020:Plxna4	UTSW	6	32234562	missense	possibly damaging	0.90
R9144:Plxna4	UTSW	6	32185561	missense	possibly damaging	0.77
R9206:Plxna4	UTSW	6	32517444	missense	probably damaging	0.98
R9208:Plxna4	UTSW	6	32517444	missense	probably damaging	0.98
R9257:Plxna4	UTSW	6	32162083	missense	probably damaging	0.99
R9269:Plxna4	UTSW	6	32178380	missense	probably benign	0.00
R9411:Plxna4	UTSW	6	32182747	missense	probably damaging	1.00
V1024:Plxna4	UTSW	6	32234574	missense	probably damaging	1.00
X0027:Plxna4	UTSW	6	32517044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCCTGTTGCTCATAGCCAAC -3'
(R):5'- GATGACGACCTCCTCTTCAC -3'

Sequencing Primer
(F):5'- TGTTGCTCATAGCCAACAAGAG -3'
(R):5'- ACCGTCTTCTCCAAGGGC -3'

Posted On

2019-05-13