Mutagenetix > Incidental Mutations

Incidental Mutation 'R7046:Mfhas1'

547321

Institutional Source

Beutler Lab

Gene Symbol

Mfhas1

Ensembl Gene

ENSMUSG00000070056

Gene Name

malignant fibrous histiocytoma amplified sequence 1

Synonyms

2310066G09Rik, D8Ertd91e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.195) question?

Stock #

R7046 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

35587798-35679449 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 35664790 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1037 (S1037P)

Ref Sequence

ENSEMBL: ENSMUSP00000044135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037666]

Predicted Effect

probably benign
Transcript: ENSMUST00000037666
AA Change: S1037P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000044135
Gene: ENSMUSG00000070056
AA Change: S1037P

Domain	Start	End	E-Value	Type
LRR	58	81	1.97e1	SMART
LRR	82	105	5.72e-1	SMART
LRR	106	125	2.79e1	SMART
LRR	130	152	8.09e-1	SMART
LRR_TYP	153	175	7.78e-3	SMART
LRR	176	195	5.48e0	SMART
LRR	199	221	6.57e-1	SMART
LRR	222	244	3.98e1	SMART
LRR	245	267	1.25e-1	SMART
LRR	268	290	3.27e1	SMART
LRR	291	313	1.43e-1	SMART
LRR	314	334	1.12e1	SMART
LRR_TYP	337	360	4.11e-2	SMART
Pfam:Roc	407	537	6.9e-11	PFAM
low complexity region	743	750	N/A	INTRINSIC
low complexity region	754	761	N/A	INTRINSIC
low complexity region	808	820	N/A	INTRINSIC
Blast:LY	1018	1038	7e-6	BLAST

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Identified in a human 8p amplicon, this gene is a potential oncogene whose expression is enhanced in some malignant fibrous histiocytomas (MFH). The primary structure of its product includes an ATP/GTP-binding site, three leucine zipper domains, and a leucine-rich tandem repeat, which are structural or functional elements for interactions among proteins related to the cell cycle, and which suggest that overexpression might be oncogenic with respect to MFH. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc8	T	C	7: 46,122,940	Y805C	probably damaging	Het
Cabp7	T	A	11: 4,738,886	I195F	probably damaging	Het
Camsap1	T	C	2: 25,945,189	N317S	probably damaging	Het
Ccdc127	T	G	13: 74,352,875	L4V	probably damaging	Het
Ccdc7a	T	C	8: 129,047,619	E145G	probably damaging	Het
Cdh10	T	A	15: 19,013,201	V629D	probably damaging	Het
Cdh23	A	C	10: 60,378,751	L1497R	probably damaging	Het
Chsy3	A	G	18: 59,409,803	K671R	probably benign	Het
Clca4b	T	C	3: 144,915,606	Y569C	probably damaging	Het
Cnga1	T	C	5: 72,629,353		probably benign	Het
Cyp51	T	A	5: 4,100,188	E178D	probably damaging	Het
Defa30	T	A	8: 21,135,455	N78K	probably benign	Het
Disp1	C	A	1: 183,087,466	R1130L	probably damaging	Het
Dnah14	G	T	1: 181,623,003	C727F	probably benign	Het
Egf	A	T	3: 129,754,958	W3R	unknown	Het
Egfem1	G	A	3: 29,082,215		probably null	Het
Epb41l1	G	T	2: 156,526,892	V682L	possibly damaging	Het
Etv1	A	G	12: 38,784,370		probably null	Het
Faap100	A	G	11: 120,377,374	F191S	possibly damaging	Het
Fam208a	A	T	14: 27,472,435	L1197F	probably damaging	Het
Fmo1	T	A	1: 162,839,694	D184V	possibly damaging	Het
Ghrl	A	G	6: 113,719,383	L16P	probably damaging	Het
Gria4	T	A	9: 4,420,278	L861F	probably damaging	Het
Gsr	T	A	8: 33,695,062	M428K	probably damaging	Het
Hspa5	C	T	2: 34,773,192	P127L	probably damaging	Het
Kbtbd12	A	G	6: 88,618,515	M111T	possibly damaging	Het
Krtap21-1	G	T	16: 89,403,735	Y6*	probably null	Het
Lin9	A	G	1: 180,667,370	D219G	probably damaging	Het
Lrrc38	A	G	4: 143,350,169	M1V	probably null	Het
Macc1	T	G	12: 119,447,038	F514V	probably benign	Het
Madcam1	C	T	10: 79,668,305	R242C	probably benign	Het
Micall2	C	T	5: 139,708,944		probably benign	Het
Mtr	C	A	13: 12,190,209	A1122S	possibly damaging	Het
Muc6	T	A	7: 141,640,189		probably benign	Het
Myh15	T	A	16: 49,109,299	C529*	probably null	Het
Napsa	T	C	7: 44,585,085	V247A	probably damaging	Het
Nr2c2	A	G	6: 92,158,357	T309A	probably damaging	Het
Olfr133	A	T	17: 38,148,800	M71L	probably benign	Het
Olfr357	T	A	2: 36,997,161	V117E	probably benign	Het
Olfr385	A	T	11: 73,589,732	I2K	probably benign	Het
Osgepl1	A	T	1: 53,321,551	I384F	possibly damaging	Het
Otud4	C	T	8: 79,651,042	L111F	possibly damaging	Het
Pds5b	A	G	5: 150,749,920	Y481C	probably damaging	Het
Pdzrn4	T	A	15: 92,770,422	Y818*	probably null	Het
Pin1rt1	T	C	2: 104,714,422	S122G	probably benign	Het
Pkdcc	A	T	17: 83,224,258	Y487F	probably damaging	Het
Plxna4	C	T	6: 32,516,505	C392Y	probably damaging	Het
Psd4	T	G	2: 24,394,973	M283R	probably benign	Het
Ralgds	G	T	2: 28,540,729	G68W	probably damaging	Het
Rmdn2	T	A	17: 79,621,379	I20N	probably damaging	Het
Sestd1	A	G	2: 77,192,566	V486A	probably benign	Het
Svs1	T	A	6: 48,987,578	D173E	probably benign	Het
Tango6	A	G	8: 106,807,116	H958R	possibly damaging	Het
Taok3	C	T	5: 117,273,706	R857C	probably damaging	Het
Theg	G	T	10: 79,586,962	D35E	probably benign	Het
Trio	T	C	15: 27,832,051	E1245G	probably damaging	Het
Usp19	C	T	9: 108,497,135	H763Y	possibly damaging	Het
Vmn1r185	A	G	7: 26,611,226	S285P	probably damaging	Het
Vmn1r45	T	G	6: 89,933,556	Y144S	probably benign	Het
Vwa3b	G	A	1: 37,173,878	E152K	probably benign	Het
Wdr61	T	A	9: 54,719,255	D275V	probably damaging	Het
Xrcc5	G	A	1: 72,394,716	M731I	probably benign	Het
Zfp619	G	A	7: 39,537,363	S939N	possibly damaging	Het
Zfp874a	C	A	13: 67,442,299	C422F	probably damaging	Het
Zfp948	A	G	17: 21,588,457	D637G	possibly damaging	Het

Other mutations in Mfhas1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00694:Mfhas1	APN	8	35590771	missense	probably benign	0.00
IGL00841:Mfhas1	APN	8	35590886	missense	probably damaging	0.97
IGL01548:Mfhas1	APN	8	35590459	missense	probably damaging	1.00
IGL02031:Mfhas1	APN	8	35589372	missense	probably damaging	0.99
IGL02093:Mfhas1	APN	8	35589344	missense	probably damaging	1.00
IGL02314:Mfhas1	APN	8	35588773	missense	probably damaging	0.98
IGL02412:Mfhas1	APN	8	35588815	missense	probably benign	0.11
IGL02638:Mfhas1	APN	8	35590950	missense	possibly damaging	0.55
IGL02663:Mfhas1	APN	8	35589906	missense	probably damaging	0.99
R0545:Mfhas1	UTSW	8	35589048	missense	probably damaging	1.00
R0619:Mfhas1	UTSW	8	35590675	missense	probably benign	0.00
R0637:Mfhas1	UTSW	8	35590026	nonsense	probably null
R1251:Mfhas1	UTSW	8	35591053	missense	probably damaging	0.97
R1829:Mfhas1	UTSW	8	35590068	missense	probably benign
R1829:Mfhas1	UTSW	8	35590248	missense	probably benign	0.09
R1839:Mfhas1	UTSW	8	35590858	missense	possibly damaging	0.95
R1934:Mfhas1	UTSW	8	35591097	missense	possibly damaging	0.52
R1937:Mfhas1	UTSW	8	35589645	missense	probably damaging	0.99
R2038:Mfhas1	UTSW	8	35591277	missense	probably damaging	1.00
R2982:Mfhas1	UTSW	8	35591115	missense	probably benign	0.07
R4566:Mfhas1	UTSW	8	35591049	missense	probably damaging	1.00
R4604:Mfhas1	UTSW	8	35588610	missense	probably benign	0.00
R4693:Mfhas1	UTSW	8	35589175	missense	probably damaging	1.00
R5205:Mfhas1	UTSW	8	35591007	missense	probably benign	0.10
R5535:Mfhas1	UTSW	8	35590269	missense	possibly damaging	0.73
R5631:Mfhas1	UTSW	8	35588419	missense	probably damaging	0.96
R5744:Mfhas1	UTSW	8	35589482	missense	probably damaging	1.00
R6580:Mfhas1	UTSW	8	35589265	missense	probably damaging	1.00
R6663:Mfhas1	UTSW	8	35589118	missense	probably damaging	1.00
R6998:Mfhas1	UTSW	8	35591356	missense	probably damaging	1.00
R7054:Mfhas1	UTSW	8	35588638	missense	probably benign	0.30
R7171:Mfhas1	UTSW	8	35588992	missense	probably benign	0.08
R7396:Mfhas1	UTSW	8	35590199	missense	probably damaging	0.97
R7557:Mfhas1	UTSW	8	35589604	missense	possibly damaging	0.50
X0060:Mfhas1	UTSW	8	35588404	missense	possibly damaging	0.52
Z1088:Mfhas1	UTSW	8	35590236	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TCTGTGTAAATTAGTCCCACTCTTTGG -3'
(R):5'- TGCTATTGAGAGAAGGGCAC -3'

Sequencing Primer
(F):5'- GGGGCCTATTTCCTAATGAATTTC -3'
(R):5'- TGAGAGAAGGGCACATATTTTTG -3'

Posted On

2019-05-13