Incidental Mutation 'R7046:Tango6'
ID547323
Institutional Source Beutler Lab
Gene Symbol Tango6
Ensembl Gene ENSMUSG00000041949
Gene Nametransport and golgi organization 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7046 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location106683068-106851439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106807116 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 958 (H958R)
Ref Sequence ENSEMBL: ENSMUSP00000043953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048359]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048359
AA Change: H958R

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000043953
Gene: ENSMUSG00000041949
AA Change: H958R

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 20 41 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
low complexity region 246 259 N/A INTRINSIC
low complexity region 334 350 N/A INTRINSIC
low complexity region 472 486 N/A INTRINSIC
Pfam:RTP1_C1 824 935 1.6e-35 PFAM
low complexity region 998 1013 N/A INTRINSIC
Pfam:RTP1_C2 1026 1059 7.5e-14 PFAM
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,122,940 Y805C probably damaging Het
Cabp7 T A 11: 4,738,886 I195F probably damaging Het
Camsap1 T C 2: 25,945,189 N317S probably damaging Het
Ccdc127 T G 13: 74,352,875 L4V probably damaging Het
Ccdc7a T C 8: 129,047,619 E145G probably damaging Het
Cdh10 T A 15: 19,013,201 V629D probably damaging Het
Cdh23 A C 10: 60,378,751 L1497R probably damaging Het
Chsy3 A G 18: 59,409,803 K671R probably benign Het
Clca4b T C 3: 144,915,606 Y569C probably damaging Het
Cnga1 T C 5: 72,629,353 probably benign Het
Cyp51 T A 5: 4,100,188 E178D probably damaging Het
Defa30 T A 8: 21,135,455 N78K probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnah14 G T 1: 181,623,003 C727F probably benign Het
Egf A T 3: 129,754,958 W3R unknown Het
Egfem1 G A 3: 29,082,215 probably null Het
Epb41l1 G T 2: 156,526,892 V682L possibly damaging Het
Etv1 A G 12: 38,784,370 probably null Het
Faap100 A G 11: 120,377,374 F191S possibly damaging Het
Fam208a A T 14: 27,472,435 L1197F probably damaging Het
Fmo1 T A 1: 162,839,694 D184V possibly damaging Het
Ghrl A G 6: 113,719,383 L16P probably damaging Het
Gria4 T A 9: 4,420,278 L861F probably damaging Het
Gsr T A 8: 33,695,062 M428K probably damaging Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Kbtbd12 A G 6: 88,618,515 M111T possibly damaging Het
Krtap21-1 G T 16: 89,403,735 Y6* probably null Het
Lin9 A G 1: 180,667,370 D219G probably damaging Het
Lrrc38 A G 4: 143,350,169 M1V probably null Het
Macc1 T G 12: 119,447,038 F514V probably benign Het
Madcam1 C T 10: 79,668,305 R242C probably benign Het
Mfhas1 T C 8: 35,664,790 S1037P probably benign Het
Micall2 C T 5: 139,708,944 probably benign Het
Mtr C A 13: 12,190,209 A1122S possibly damaging Het
Muc6 T A 7: 141,640,189 probably benign Het
Myh15 T A 16: 49,109,299 C529* probably null Het
Napsa T C 7: 44,585,085 V247A probably damaging Het
Nr2c2 A G 6: 92,158,357 T309A probably damaging Het
Olfr133 A T 17: 38,148,800 M71L probably benign Het
Olfr357 T A 2: 36,997,161 V117E probably benign Het
Olfr385 A T 11: 73,589,732 I2K probably benign Het
Osgepl1 A T 1: 53,321,551 I384F possibly damaging Het
Otud4 C T 8: 79,651,042 L111F possibly damaging Het
Pds5b A G 5: 150,749,920 Y481C probably damaging Het
Pdzrn4 T A 15: 92,770,422 Y818* probably null Het
Pin1rt1 T C 2: 104,714,422 S122G probably benign Het
Pkdcc A T 17: 83,224,258 Y487F probably damaging Het
Plxna4 C T 6: 32,516,505 C392Y probably damaging Het
Psd4 T G 2: 24,394,973 M283R probably benign Het
Ralgds G T 2: 28,540,729 G68W probably damaging Het
Rmdn2 T A 17: 79,621,379 I20N probably damaging Het
Sestd1 A G 2: 77,192,566 V486A probably benign Het
Svs1 T A 6: 48,987,578 D173E probably benign Het
Taok3 C T 5: 117,273,706 R857C probably damaging Het
Theg G T 10: 79,586,962 D35E probably benign Het
Trio T C 15: 27,832,051 E1245G probably damaging Het
Usp19 C T 9: 108,497,135 H763Y possibly damaging Het
Vmn1r185 A G 7: 26,611,226 S285P probably damaging Het
Vmn1r45 T G 6: 89,933,556 Y144S probably benign Het
Vwa3b G A 1: 37,173,878 E152K probably benign Het
Wdr61 T A 9: 54,719,255 D275V probably damaging Het
Xrcc5 G A 1: 72,394,716 M731I probably benign Het
Zfp619 G A 7: 39,537,363 S939N possibly damaging Het
Zfp874a C A 13: 67,442,299 C422F probably damaging Het
Zfp948 A G 17: 21,588,457 D637G possibly damaging Het
Other mutations in Tango6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Tango6 APN 8 106742472 critical splice donor site probably null
IGL00925:Tango6 APN 8 106695445 splice site probably benign
IGL00965:Tango6 APN 8 106742010 splice site probably benign
IGL01412:Tango6 APN 8 106818499 missense probably benign 0.02
IGL02888:Tango6 APN 8 106720665 missense probably damaging 1.00
IGL02892:Tango6 APN 8 106742010 splice site probably benign
R0241:Tango6 UTSW 8 106747361 splice site probably benign
R0494:Tango6 UTSW 8 106735682 splice site probably benign
R1127:Tango6 UTSW 8 106688895 missense probably benign 0.00
R1440:Tango6 UTSW 8 106689039 missense probably damaging 1.00
R1547:Tango6 UTSW 8 106781786 missense probably damaging 0.98
R1921:Tango6 UTSW 8 106688794 missense probably benign 0.06
R2255:Tango6 UTSW 8 106689294 critical splice donor site probably null
R2761:Tango6 UTSW 8 106699032 missense possibly damaging 0.93
R4211:Tango6 UTSW 8 106689224 missense probably benign 0.02
R4463:Tango6 UTSW 8 106689074 missense probably benign 0.29
R4696:Tango6 UTSW 8 106700231 missense possibly damaging 0.73
R4867:Tango6 UTSW 8 106818526 missense probably damaging 1.00
R4946:Tango6 UTSW 8 106718090 nonsense probably null
R5459:Tango6 UTSW 8 106850289 missense probably damaging 1.00
R5522:Tango6 UTSW 8 106695598 critical splice donor site probably null
R5795:Tango6 UTSW 8 106718077 missense probably damaging 1.00
R5878:Tango6 UTSW 8 106689168 missense possibly damaging 0.77
R6318:Tango6 UTSW 8 106818497 missense probably benign
R6335:Tango6 UTSW 8 106692676 missense possibly damaging 0.94
R6633:Tango6 UTSW 8 106718005 missense probably benign 0.00
R6664:Tango6 UTSW 8 106742114 missense probably damaging 1.00
R6838:Tango6 UTSW 8 106742074 missense probably benign 0.00
R6866:Tango6 UTSW 8 106742472 critical splice donor site probably null
R7130:Tango6 UTSW 8 106807101 missense probably damaging 1.00
R7199:Tango6 UTSW 8 106689159 missense probably benign 0.01
R7418:Tango6 UTSW 8 106688834 missense probably benign 0.26
R7480:Tango6 UTSW 8 106696727 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CCCTGAGCACAACTTTCAGTG -3'
(R):5'- GGTTAAATGACTGATCTGTCCAGTC -3'

Sequencing Primer
(F):5'- TTGTCTATGTCCACTGCAGAG -3'
(R):5'- ACTGATCTGTCCAGTCAGAGG -3'
Posted On2019-05-13