Incidental Mutation 'R7046:Madcam1'
ID547330
Institutional Source Beutler Lab
Gene Symbol Madcam1
Ensembl Gene ENSMUSG00000020310
Gene Namemucosal vascular addressin cell adhesion molecule 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7046 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79664559-79668537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 79668305 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 242 (R242C)
Ref Sequence ENSEMBL: ENSMUSP00000151928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020552] [ENSMUST00000020554] [ENSMUST00000217748]
Predicted Effect probably benign
Transcript: ENSMUST00000020552
SMART Domains Protein: ENSMUSP00000020552
Gene: ENSMUSG00000020308

DomainStartEndE-ValueType
low complexity region 94 114 N/A INTRINSIC
Blast:UBCc 125 156 9e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000020554
AA Change: R386C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020554
Gene: ENSMUSG00000020310
AA Change: R386C

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:ICAM_N 21 114 7.3e-8 PFAM
Pfam:Adhes-Ig_like 110 220 2.4e-57 PFAM
Blast:IG_like 278 354 3e-14 BLAST
transmembrane domain 366 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217748
AA Change: R242C

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (63/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit small Peyer's patches and decreased homing of IgA-secreting plasma cells in the lamina propria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,122,940 Y805C probably damaging Het
Cabp7 T A 11: 4,738,886 I195F probably damaging Het
Camsap1 T C 2: 25,945,189 N317S probably damaging Het
Ccdc127 T G 13: 74,352,875 L4V probably damaging Het
Ccdc7a T C 8: 129,047,619 E145G probably damaging Het
Cdh10 T A 15: 19,013,201 V629D probably damaging Het
Cdh23 A C 10: 60,378,751 L1497R probably damaging Het
Chsy3 A G 18: 59,409,803 K671R probably benign Het
Clca4b T C 3: 144,915,606 Y569C probably damaging Het
Cnga1 T C 5: 72,629,353 probably benign Het
Cyp51 T A 5: 4,100,188 E178D probably damaging Het
Defa30 T A 8: 21,135,455 N78K probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnah14 G T 1: 181,623,003 C727F probably benign Het
Egf A T 3: 129,754,958 W3R unknown Het
Egfem1 G A 3: 29,082,215 probably null Het
Epb41l1 G T 2: 156,526,892 V682L possibly damaging Het
Etv1 A G 12: 38,784,370 probably null Het
Faap100 A G 11: 120,377,374 F191S possibly damaging Het
Fam208a A T 14: 27,472,435 L1197F probably damaging Het
Fmo1 T A 1: 162,839,694 D184V possibly damaging Het
Ghrl A G 6: 113,719,383 L16P probably damaging Het
Gria4 T A 9: 4,420,278 L861F probably damaging Het
Gsr T A 8: 33,695,062 M428K probably damaging Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Kbtbd12 A G 6: 88,618,515 M111T possibly damaging Het
Krtap21-1 G T 16: 89,403,735 Y6* probably null Het
Lin9 A G 1: 180,667,370 D219G probably damaging Het
Lrrc38 A G 4: 143,350,169 M1V probably null Het
Macc1 T G 12: 119,447,038 F514V probably benign Het
Mfhas1 T C 8: 35,664,790 S1037P probably benign Het
Micall2 C T 5: 139,708,944 probably benign Het
Mtr C A 13: 12,190,209 A1122S possibly damaging Het
Muc6 T A 7: 141,640,189 probably benign Het
Myh15 T A 16: 49,109,299 C529* probably null Het
Napsa T C 7: 44,585,085 V247A probably damaging Het
Nr2c2 A G 6: 92,158,357 T309A probably damaging Het
Olfr133 A T 17: 38,148,800 M71L probably benign Het
Olfr357 T A 2: 36,997,161 V117E probably benign Het
Olfr385 A T 11: 73,589,732 I2K probably benign Het
Osgepl1 A T 1: 53,321,551 I384F possibly damaging Het
Otud4 C T 8: 79,651,042 L111F possibly damaging Het
Pds5b A G 5: 150,749,920 Y481C probably damaging Het
Pdzrn4 T A 15: 92,770,422 Y818* probably null Het
Pin1rt1 T C 2: 104,714,422 S122G probably benign Het
Pkdcc A T 17: 83,224,258 Y487F probably damaging Het
Plxna4 C T 6: 32,516,505 C392Y probably damaging Het
Psd4 T G 2: 24,394,973 M283R probably benign Het
Ralgds G T 2: 28,540,729 G68W probably damaging Het
Rmdn2 T A 17: 79,621,379 I20N probably damaging Het
Sestd1 A G 2: 77,192,566 V486A probably benign Het
Svs1 T A 6: 48,987,578 D173E probably benign Het
Tango6 A G 8: 106,807,116 H958R possibly damaging Het
Taok3 C T 5: 117,273,706 R857C probably damaging Het
Theg G T 10: 79,586,962 D35E probably benign Het
Trio T C 15: 27,832,051 E1245G probably damaging Het
Usp19 C T 9: 108,497,135 H763Y possibly damaging Het
Vmn1r185 A G 7: 26,611,226 S285P probably damaging Het
Vmn1r45 T G 6: 89,933,556 Y144S probably benign Het
Vwa3b G A 1: 37,173,878 E152K probably benign Het
Wdr61 T A 9: 54,719,255 D275V probably damaging Het
Xrcc5 G A 1: 72,394,716 M731I probably benign Het
Zfp619 G A 7: 39,537,363 S939N possibly damaging Het
Zfp874a C A 13: 67,442,299 C422F probably damaging Het
Zfp948 A G 17: 21,588,457 D637G possibly damaging Het
Other mutations in Madcam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1491:Madcam1 UTSW 10 79666524 missense probably benign 0.03
R2128:Madcam1 UTSW 10 79665572 missense possibly damaging 0.93
R2129:Madcam1 UTSW 10 79665572 missense possibly damaging 0.93
R3713:Madcam1 UTSW 10 79668360 missense probably benign
R4932:Madcam1 UTSW 10 79665613 nonsense probably null
R5212:Madcam1 UTSW 10 79668345 missense probably benign 0.22
R5256:Madcam1 UTSW 10 79664945 missense possibly damaging 0.72
R5849:Madcam1 UTSW 10 79664990 missense probably benign 0.02
R6816:Madcam1 UTSW 10 79665440 missense probably damaging 1.00
R7209:Madcam1 UTSW 10 79665058 missense possibly damaging 0.53
X0017:Madcam1 UTSW 10 79664999 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTAGAGGCTGGCTAGTTAAGTC -3'
(R):5'- TATTTAGCTCTGGGCCAGCAG -3'

Sequencing Primer
(F):5'- GTCCACTTTTAAACTGTAAGGGCC -3'
(R):5'- CCCAGAAGTCAGGAGAAACTTATAG -3'
Posted On2019-05-13