Mutagenetix > Incidental Mutations

Incidental Mutation 'R7046:Trio'

547340

Institutional Source

Beutler Lab

Gene Symbol

Trio

Ensembl Gene

ENSMUSG00000022263

Gene Name

triple functional domain (PTPRF interacting)

Synonyms

Solo, 6720464I07Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7046 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

27730651-28025848 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 27832051 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1245 (E1245G)

Ref Sequence

ENSEMBL: ENSMUSP00000154653 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000226644] [ENSMUST00000227337]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000090247
AA Change: E1304G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: E1304G

Domain	Start	End	E-Value	Type
low complexity region	2	40	N/A	INTRINSIC
SEC14	68	207	3.4e-26	SMART
SPEC	221	337	2.48e-9	SMART
SPEC	343	445	1.92e-15	SMART
SPEC	569	671	5.35e-14	SMART
SPEC	674	783	1.18e-6	SMART
SPEC	910	1011	2.6e-12	SMART
SPEC	1141	1243	7e-18	SMART
low complexity region	1249	1258	N/A	INTRINSIC
RhoGEF	1296	1466	2.79e-53	SMART
PH	1480	1593	1.53e-9	SMART
SH3	1659	1720	1.9e-8	SMART
low complexity region	1788	1802	N/A	INTRINSIC
low complexity region	1837	1863	N/A	INTRINSIC
low complexity region	1936	1954	N/A	INTRINSIC
RhoGEF	1973	2144	1.32e-63	SMART
PH	2158	2273	3.6e-6	SMART
low complexity region	2291	2341	N/A	INTRINSIC
low complexity region	2371	2390	N/A	INTRINSIC
low complexity region	2491	2503	N/A	INTRINSIC
SH3	2558	2619	1.04e0	SMART
low complexity region	2640	2660	N/A	INTRINSIC
IGc2	2701	2770	4e-12	SMART
S_TKc	2800	3054	4.84e-72	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000226644
AA Change: E160G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000227337
AA Change: E1245G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.9634

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc8	T	C	7: 46,122,940	Y805C	probably damaging	Het
Cabp7	T	A	11: 4,738,886	I195F	probably damaging	Het
Camsap1	T	C	2: 25,945,189	N317S	probably damaging	Het
Ccdc127	T	G	13: 74,352,875	L4V	probably damaging	Het
Ccdc7a	T	C	8: 129,047,619	E145G	probably damaging	Het
Cdh10	T	A	15: 19,013,201	V629D	probably damaging	Het
Cdh23	A	C	10: 60,378,751	L1497R	probably damaging	Het
Chsy3	A	G	18: 59,409,803	K671R	probably benign	Het
Clca4b	T	C	3: 144,915,606	Y569C	probably damaging	Het
Cnga1	T	C	5: 72,629,353		probably benign	Het
Cyp51	T	A	5: 4,100,188	E178D	probably damaging	Het
Defa30	T	A	8: 21,135,455	N78K	probably benign	Het
Disp1	C	A	1: 183,087,466	R1130L	probably damaging	Het
Dnah14	G	T	1: 181,623,003	C727F	probably benign	Het
Egf	A	T	3: 129,754,958	W3R	unknown	Het
Egfem1	G	A	3: 29,082,215		probably null	Het
Epb41l1	G	T	2: 156,526,892	V682L	possibly damaging	Het
Etv1	A	G	12: 38,784,370		probably null	Het
Faap100	A	G	11: 120,377,374	F191S	possibly damaging	Het
Fam208a	A	T	14: 27,472,435	L1197F	probably damaging	Het
Fmo1	T	A	1: 162,839,694	D184V	possibly damaging	Het
Ghrl	A	G	6: 113,719,383	L16P	probably damaging	Het
Gria4	T	A	9: 4,420,278	L861F	probably damaging	Het
Gsr	T	A	8: 33,695,062	M428K	probably damaging	Het
Hspa5	C	T	2: 34,773,192	P127L	probably damaging	Het
Kbtbd12	A	G	6: 88,618,515	M111T	possibly damaging	Het
Krtap21-1	G	T	16: 89,403,735	Y6*	probably null	Het
Lin9	A	G	1: 180,667,370	D219G	probably damaging	Het
Lrrc38	A	G	4: 143,350,169	M1V	probably null	Het
Macc1	T	G	12: 119,447,038	F514V	probably benign	Het
Madcam1	C	T	10: 79,668,305	R242C	probably benign	Het
Mfhas1	T	C	8: 35,664,790	S1037P	probably benign	Het
Micall2	C	T	5: 139,708,944		probably benign	Het
Mtr	C	A	13: 12,190,209	A1122S	possibly damaging	Het
Muc6	T	A	7: 141,640,189		probably benign	Het
Myh15	T	A	16: 49,109,299	C529*	probably null	Het
Napsa	T	C	7: 44,585,085	V247A	probably damaging	Het
Nr2c2	A	G	6: 92,158,357	T309A	probably damaging	Het
Olfr133	A	T	17: 38,148,800	M71L	probably benign	Het
Olfr357	T	A	2: 36,997,161	V117E	probably benign	Het
Olfr385	A	T	11: 73,589,732	I2K	probably benign	Het
Osgepl1	A	T	1: 53,321,551	I384F	possibly damaging	Het
Otud4	C	T	8: 79,651,042	L111F	possibly damaging	Het
Pds5b	A	G	5: 150,749,920	Y481C	probably damaging	Het
Pdzrn4	T	A	15: 92,770,422	Y818*	probably null	Het
Pin1rt1	T	C	2: 104,714,422	S122G	probably benign	Het
Pkdcc	A	T	17: 83,224,258	Y487F	probably damaging	Het
Plxna4	C	T	6: 32,516,505	C392Y	probably damaging	Het
Psd4	T	G	2: 24,394,973	M283R	probably benign	Het
Ralgds	G	T	2: 28,540,729	G68W	probably damaging	Het
Rmdn2	T	A	17: 79,621,379	I20N	probably damaging	Het
Sestd1	A	G	2: 77,192,566	V486A	probably benign	Het
Svs1	T	A	6: 48,987,578	D173E	probably benign	Het
Tango6	A	G	8: 106,807,116	H958R	possibly damaging	Het
Taok3	C	T	5: 117,273,706	R857C	probably damaging	Het
Theg	G	T	10: 79,586,962	D35E	probably benign	Het
Usp19	C	T	9: 108,497,135	H763Y	possibly damaging	Het
Vmn1r185	A	G	7: 26,611,226	S285P	probably damaging	Het
Vmn1r45	T	G	6: 89,933,556	Y144S	probably benign	Het
Vwa3b	G	A	1: 37,173,878	E152K	probably benign	Het
Wdr61	T	A	9: 54,719,255	D275V	probably damaging	Het
Xrcc5	G	A	1: 72,394,716	M731I	probably benign	Het
Zfp619	G	A	7: 39,537,363	S939N	possibly damaging	Het
Zfp874a	C	A	13: 67,442,299	C422F	probably damaging	Het
Zfp948	A	G	17: 21,588,457	D637G	possibly damaging	Het

Other mutations in Trio

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Trio	APN	15	27912743	splice site	probably benign
IGL01011:Trio	APN	15	27736489	missense	probably damaging	0.96
IGL01090:Trio	APN	15	27773007	missense	probably damaging	1.00
IGL01145:Trio	APN	15	27818167	splice site	probably benign
IGL01147:Trio	APN	15	27881320	missense	probably damaging	1.00
IGL01161:Trio	APN	15	27749781	missense	probably damaging	1.00
IGL01324:Trio	APN	15	27905323	missense	probably benign	0.42
IGL01352:Trio	APN	15	27901229	missense	probably benign	0.01
IGL01366:Trio	APN	15	27732868	missense	possibly damaging	0.76
IGL01443:Trio	APN	15	27838775	splice site	probably benign
IGL01454:Trio	APN	15	27832985	missense	probably benign	0.32
IGL01695:Trio	APN	15	27773001	missense	probably damaging	1.00
IGL01765:Trio	APN	15	27764026	missense	possibly damaging	0.85
IGL01860:Trio	APN	15	27846810	missense	probably damaging	1.00
IGL01879:Trio	APN	15	27741033	missense	probably benign	0.12
IGL01991:Trio	APN	15	27871274	missense	possibly damaging	0.95
IGL02106:Trio	APN	15	27744158	missense	possibly damaging	0.85
IGL02209:Trio	APN	15	27744053	missense	probably damaging	1.00
IGL02232:Trio	APN	15	27902561	missense	probably benign	0.24
IGL02304:Trio	APN	15	27735436	missense	probably damaging	0.96
IGL02504:Trio	APN	15	27847390	nonsense	probably null
IGL02508:Trio	APN	15	27818104	missense	possibly damaging	0.65
IGL02541:Trio	APN	15	27844930	splice site	probably benign
IGL02617:Trio	APN	15	27841849	splice site	probably benign
IGL02675:Trio	APN	15	27768039	unclassified	probably benign
IGL02817:Trio	APN	15	27902881	missense	probably benign	0.01
IGL02993:Trio	APN	15	27830239	splice site	probably benign
IGL03007:Trio	APN	15	27902742	missense	probably damaging	0.99
IGL03135:Trio	APN	15	27832011	splice site	probably benign
IGL03225:Trio	APN	15	27902695	missense	probably benign	0.30
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0302:Trio	UTSW	15	27902517	missense	probably damaging	1.00
R0505:Trio	UTSW	15	27767907	missense	probably benign	0.00
R0506:Trio	UTSW	15	27854963	missense	probably benign	0.12
R0564:Trio	UTSW	15	27805822	missense	probably damaging	1.00
R0659:Trio	UTSW	15	27831399	missense	probably damaging	0.97
R0882:Trio	UTSW	15	27732894	missense	probably damaging	1.00
R0939:Trio	UTSW	15	27741250	critical splice donor site	probably null
R1018:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R1439:Trio	UTSW	15	27897914	missense	probably damaging	1.00
R1456:Trio	UTSW	15	27753804	splice site	probably benign
R1488:Trio	UTSW	15	27740967	missense	probably damaging	1.00
R1522:Trio	UTSW	15	27732640	missense	probably benign	0.28
R1531:Trio	UTSW	15	27832985	missense	probably benign	0.32
R1640:Trio	UTSW	15	27833044	missense	probably damaging	1.00
R1646:Trio	UTSW	15	27758347	missense	possibly damaging	0.91
R1682:Trio	UTSW	15	27744146	splice site	probably null
R1780:Trio	UTSW	15	27744038	missense	possibly damaging	0.93
R1791:Trio	UTSW	15	27841756	missense	probably damaging	1.00
R1803:Trio	UTSW	15	27748340	missense	probably benign
R1817:Trio	UTSW	15	27742495	nonsense	probably null
R1853:Trio	UTSW	15	27756536	missense	probably damaging	1.00
R1898:Trio	UTSW	15	27742380	missense	possibly damaging	0.52
R1937:Trio	UTSW	15	27833056	missense	probably damaging	1.00
R1938:Trio	UTSW	15	27732891	missense	probably damaging	0.98
R2025:Trio	UTSW	15	27744137	missense	probably damaging	0.99
R2025:Trio	UTSW	15	27773927	missense	probably damaging	1.00
R2050:Trio	UTSW	15	27851945	missense	possibly damaging	0.85
R2186:Trio	UTSW	15	27823975	splice site	probably null
R2913:Trio	UTSW	15	27854912	missense	probably damaging	1.00
R3151:Trio	UTSW	15	27805776	missense	probably damaging	1.00
R3771:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3773:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3826:Trio	UTSW	15	27833070	missense	probably damaging	1.00
R4015:Trio	UTSW	15	27744101	missense	possibly damaging	0.71
R4359:Trio	UTSW	15	27749797	nonsense	probably null
R4370:Trio	UTSW	15	27748337	nonsense	probably null
R4547:Trio	UTSW	15	27818982	missense	possibly damaging	0.89
R4573:Trio	UTSW	15	27772998	small deletion	probably benign
R4620:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R4735:Trio	UTSW	15	27752789	splice site	probably null
R4764:Trio	UTSW	15	27732538	nonsense	probably null
R4775:Trio	UTSW	15	27881342	nonsense	probably null
R4942:Trio	UTSW	15	27752725	missense	probably benign	0.21
R5004:Trio	UTSW	15	27755178	missense	probably damaging	1.00
R5149:Trio	UTSW	15	27754029	missense	possibly damaging	0.74
R5183:Trio	UTSW	15	27902600	missense	probably benign	0.00
R5186:Trio	UTSW	15	27897991	missense	probably damaging	0.97
R5268:Trio	UTSW	15	27748286	missense	probably benign	0.02
R5344:Trio	UTSW	15	27735532	missense	probably benign	0.12
R5407:Trio	UTSW	15	27844806	splice site	probably null
R5442:Trio	UTSW	15	27856194	missense	probably benign	0.04
R5617:Trio	UTSW	15	27902748	missense	probably benign
R5778:Trio	UTSW	15	27856164	missense	probably benign	0.33
R5986:Trio	UTSW	15	27851933	missense	possibly damaging	0.88
R5990:Trio	UTSW	15	27891459	missense	probably benign	0.10
R6011:Trio	UTSW	15	27735545	missense	probably damaging	0.98
R6063:Trio	UTSW	15	27891379	missense	possibly damaging	0.94
R6166:Trio	UTSW	15	27818071	missense	probably damaging	0.96
R6187:Trio	UTSW	15	27743952	critical splice donor site	probably null
R6387:Trio	UTSW	15	27752739	missense	probably damaging	1.00
R6402:Trio	UTSW	15	27902911	missense	probably benign	0.02
R6478:Trio	UTSW	15	27856107	missense	probably benign	0.01
R6528:Trio	UTSW	15	27805870	missense	probably damaging	1.00
R6662:Trio	UTSW	15	27854996	missense	probably benign	0.00
R6825:Trio	UTSW	15	27889308	missense	probably damaging	0.98
R6890:Trio	UTSW	15	27919288	unclassified	probably benign
R6945:Trio	UTSW	15	27824090	missense	probably damaging	1.00
R7027:Trio	UTSW	15	27805654	missense	possibly damaging	0.86
R7049:Trio	UTSW	15	27749799	missense	possibly damaging	0.66
R7075:Trio	UTSW	15	27898000	missense	unknown
R7094:Trio	UTSW	15	27891448	missense	unknown
R7123:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7130:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7214:Trio	UTSW	15	27871187	missense	probably damaging	0.97
R7292:Trio	UTSW	15	27828351	missense	possibly damaging	0.63
R7293:Trio	UTSW	15	27871289	missense	possibly damaging	0.66
R7352:Trio	UTSW	15	27732876	missense	probably damaging	0.96
R7426:Trio	UTSW	15	27856107	missense	probably benign	0.01
R7451:Trio	UTSW	15	27747913	missense	probably benign	0.07
R7558:Trio	UTSW	15	27831394	missense	possibly damaging	0.90
R7578:Trio	UTSW	15	27854939	missense	possibly damaging	0.94
R7596:Trio	UTSW	15	27749826	missense	probably damaging	0.99
R7604:Trio	UTSW	15	27736445	critical splice donor site	probably null
R7609:Trio	UTSW	15	27912642	missense	unknown
R7767:Trio	UTSW	15	27889418	missense	unknown
R7784:Trio	UTSW	15	27763994	missense	probably damaging	1.00
R7817:Trio	UTSW	15	27749866	missense	probably benign	0.35
R7833:Trio	UTSW	15	27774086	missense	probably damaging	0.99
R7873:Trio	UTSW	15	27805684	missense	possibly damaging	0.83
R7879:Trio	UTSW	15	27851924	missense	possibly damaging	0.94
R7989:Trio	UTSW	15	27772935	missense	probably damaging	0.97
R8022:Trio	UTSW	15	27749866	missense	probably benign	0.35
R8050:Trio	UTSW	15	27891454	missense	unknown
R8217:Trio	UTSW	15	27818969	missense	probably damaging	0.97
R8280:Trio	UTSW	15	27902910	missense	unknown
R8283:Trio	UTSW	15	27756542	missense	possibly damaging	0.79
R8300:Trio	UTSW	15	27855022	missense	possibly damaging	0.66
R8321:Trio	UTSW	15	27881326	missense	possibly damaging	0.90
R8477:Trio	UTSW	15	27773952	missense	possibly damaging	0.83
R8479:Trio	UTSW	15	27901200	missense	probably benign	0.25
R8682:Trio	UTSW	15	27905192	missense	unknown
R8688:Trio	UTSW	15	27748238	missense	possibly damaging	0.61
R8708:Trio	UTSW	15	27732546	missense	probably damaging	0.99
R8709:Trio	UTSW	15	27919237	missense	unknown
R8713:Trio	UTSW	15	27743951	critical splice donor site	probably benign
R8798:Trio	UTSW	15	27851837	missense	possibly damaging	0.92
R8812:Trio	UTSW	15	27905225	missense	unknown
R8816:Trio	UTSW	15	27741271	missense	probably damaging	0.96
R8828:Trio	UTSW	15	27741064	missense	possibly damaging	0.93
R8987:Trio	UTSW	15	27732687	missense	probably benign	0.23
R9051:Trio	UTSW	15	27732684	missense	possibly damaging	0.78
R9069:Trio	UTSW	15	27852011	missense	possibly damaging	0.83
R9075:Trio	UTSW	15	27773936	nonsense	probably null
R9079:Trio	UTSW	15	27732937	missense	possibly damaging	0.52
R9139:Trio	UTSW	15	27749836	nonsense	probably null
X0024:Trio	UTSW	15	27765726	missense	possibly damaging	0.91
Z1176:Trio	UTSW	15	27771387	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCCAGCATGTGACAGATGAATG -3'
(R):5'- AGTCGATGGCTGCTATTCTGTC -3'

Sequencing Primer
(F):5'- TGCCATGTGCGGTGAGC -3'
(R):5'- GTCGATGGCTGCTATTCTGTCTAATC -3'

Posted On

2019-05-13