Mutagenetix > Incidental Mutations

Incidental Mutation 'R7047:Ext2'

547358

Institutional Source

Beutler Lab

Gene Symbol

Ext2

Ensembl Gene

ENSMUSG00000027198

Gene Name

exostoses (multiple) 2

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7047 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

93661028-93822568 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 93739657 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 470 (F470L)

Ref Sequence

ENSEMBL: ENSMUSP00000138956 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028623] [ENSMUST00000125407] [ENSMUST00000184931]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028623
AA Change: F470L

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000028623
Gene: ENSMUSG00000027198
AA Change: F470L

Domain	Start	End	E-Value	Type
transmembrane domain	24	46	N/A	INTRINSIC
Pfam:Exostosin	100	380	2.4e-59	PFAM
Pfam:Glyco_transf_64	456	701	1.1e-99	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000125407

SMART Domains

Protein: ENSMUSP00000120291
Gene: ENSMUSG00000027198

Domain	Start	End	E-Value	Type
transmembrane domain	24	46	N/A	INTRINSIC
Pfam:Exostosin	100	380	8.8e-59	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000184931
AA Change: F470L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000138956
Gene: ENSMUSG00000027198
AA Change: F470L

Domain	Start	End	E-Value	Type
transmembrane domain	24	46	N/A	INTRINSIC
Pfam:Exostosin	100	380	1.4e-57	PFAM
Pfam:Glyco_transf_64	456	559	9.5e-31	PFAM

Meta Mutation Damage Score

0.4970

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two glycosyltransferases involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type II form of multiple exostoses. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos lack heparan sulfate, initiate primitive streak formation but fail to form mesoderm, become growth arrested and die around gastrulation. Heterozygotes show various abnormalities in cartilage differentiation; about one-third form one or more exostoses on the ribs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	T	14: 32,660,174	I1278N	possibly damaging	Het
Adcy5	T	A	16: 35,267,215	L482Q	probably damaging	Het
Adora2a	A	G	10: 75,326,311	I95V	probably damaging	Het
Anapc1	A	C	2: 128,615,430	C1887G	probably damaging	Het
Arfgef2	T	A	2: 166,851,945		probably null	Het
Capn11	G	T	17: 45,638,696	S448*	probably null	Het
Capn7	C	T	14: 31,336,685		probably benign	Het
Cep55	T	A	19: 38,060,091	V65D	possibly damaging	Het
Col5a1	A	G	2: 27,928,084	K107R	unknown	Het
Dbh	T	A	2: 27,165,610	I32N	possibly damaging	Het
Disp1	C	A	1: 183,087,466	R1130L	probably damaging	Het
Dzip3	A	T	16: 48,982,126	N13K	probably benign	Het
Emilin1	A	G	5: 30,917,078	N221S	probably benign	Het
Fam71f1	T	A	6: 29,323,810	L178H	probably damaging	Het
Filip1	T	A	9: 79,853,634	Q206L	probably damaging	Het
Gpr63	G	T	4: 25,007,320	A15S	probably benign	Het
Grhl3	T	C	4: 135,549,240		probably null	Het
Hspa5	C	T	2: 34,773,192	P127L	probably damaging	Het
Ift172	G	T	5: 31,275,894	Y193*	probably null	Het
Ints1	A	C	5: 139,758,471	L1512*	probably null	Het
Kat2b	A	G	17: 53,663,569	Q661R	probably benign	Het
Kat6a	A	G	8: 22,938,538	N1303S	possibly damaging	Het
L3mbtl4	G	T	17: 68,461,566	R223L	probably benign	Het
Maml2	T	C	9: 13,620,881		probably benign	Het
Mixl1	A	G	1: 180,696,618		probably null	Het
Mocs1	T	C	17: 49,452,859		probably null	Het
Ms4a15	T	G	19: 10,984,872	N36T	probably damaging	Het
Msr1	G	A	8: 39,642,616	T2I	possibly damaging	Het
Nlgn1	A	C	3: 25,436,035	Y509*	probably null	Het
Nsmce1	C	A	7: 125,491,434	G4C	probably benign	Het
Olfr1218	A	T	2: 89,055,146	F93L	probably damaging	Het
Olfr621-ps1	A	G	7: 103,629,711	V83A	probably damaging	Het
Pan3	G	A	5: 147,546,365	G452D	probably damaging	Het
Pcyox1	G	T	6: 86,388,909	P441H	probably damaging	Het
Phf12	T	C	11: 78,013,273	V273A	probably damaging	Het
Plcd4	A	G	1: 74,551,989	E181G	possibly damaging	Het
Ptgfr	A	T	3: 151,835,541	I110N	possibly damaging	Het
Rab40c	A	C	17: 25,919,484	V8G	probably damaging	Het
Rasal3	T	A	17: 32,396,484	Y460F	probably damaging	Het
Rhbdf2	A	G	11: 116,603,651		probably null	Het
Ryr2	T	A	13: 11,824,400	N496Y	possibly damaging	Het
Sacs	A	T	14: 61,213,002	I4166F	probably damaging	Het
Sh2d3c	T	C	2: 32,721,160	M1T	probably null	Het
Smarca2	C	T	19: 26,669,155	S651L	possibly damaging	Het
Sned1	A	T	1: 93,285,818	R1204S	possibly damaging	Het
Spata31d1b	T	C	13: 59,712,435	Y41H	probably damaging	Het
Stab2	C	T	10: 86,858,152	C2075Y	probably damaging	Het
Tcte1	A	T	17: 45,533,368	Q90L	possibly damaging	Het
Tll2	C	T	19: 41,086,240	G945S	probably damaging	Het
Tmbim7	A	T	5: 3,670,112	T116S	probably benign	Het
Tnfrsf19	A	T	14: 61,005,218	C72*	probably null	Het
Usp17le	T	A	7: 104,768,433	T501S	probably benign	Het
Wnt5b	T	A	6: 119,448,256		probably benign	Het

Other mutations in Ext2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01132:Ext2	APN	2	93791073	missense	probably benign
IGL01554:Ext2	APN	2	93811949	missense	probably damaging	1.00
IGL01768:Ext2	APN	2	93791110	splice site	probably benign
IGL02160:Ext2	APN	2	93813584	missense	probably benign
IGL02677:Ext2	APN	2	93707245	missense	probably damaging	1.00
IGL02939:Ext2	APN	2	93704619	splice site	probably null
IGL03013:Ext2	APN	2	93707226	intron	probably benign
IGL03286:Ext2	APN	2	93707272	missense	probably damaging	1.00
R0018:Ext2	UTSW	2	93795692	missense	probably damaging	1.00
R0526:Ext2	UTSW	2	93806085	missense	probably damaging	0.99
R0580:Ext2	UTSW	2	93795725	missense	probably benign	0.31
R1383:Ext2	UTSW	2	93806113	missense	possibly damaging	0.92
R1538:Ext2	UTSW	2	93707287	missense	probably damaging	1.00
R1743:Ext2	UTSW	2	93730225	missense	probably damaging	1.00
R1792:Ext2	UTSW	2	93704545	missense	probably damaging	1.00
R2874:Ext2	UTSW	2	93739686	missense	possibly damaging	0.95
R3122:Ext2	UTSW	2	93813825	missense	probably damaging	1.00
R4624:Ext2	UTSW	2	93703200	missense	probably benign	0.26
R4653:Ext2	UTSW	2	93696159	missense	probably benign	0.22
R4826:Ext2	UTSW	2	93762630	missense	probably benign	0.15
R4828:Ext2	UTSW	2	93795767	missense	probably benign	0.08
R4936:Ext2	UTSW	2	93813679	nonsense	probably null
R5311:Ext2	UTSW	2	93696261	missense	probably benign	0.04
R5799:Ext2	UTSW	2	93811972	missense	probably benign	0.01
R5850:Ext2	UTSW	2	93813659	missense	possibly damaging	0.94
R6230:Ext2	UTSW	2	93762620	missense	probably damaging	1.00
R6488:Ext2	UTSW	2	93806085	missense	probably damaging	0.99
R7173:Ext2	UTSW	2	93813612	missense	probably damaging	1.00
R7391:Ext2	UTSW	2	93730267	missense	probably damaging	1.00
R7530:Ext2	UTSW	2	93661653	missense	probably benign	0.00
R7545:Ext2	UTSW	2	93813763	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AACAGCAGGGTCACATTGCC -3'
(R):5'- AATGGCTGAGCTCTTTCTGG -3'

Sequencing Primer
(F):5'- AGGGTCACATTGCCTTGCC -3'
(R):5'- CTCTTTCTGGTGTTGGGCAAAGC -3'

Posted On

2019-05-13