Incidental Mutation 'R7047:Fam71f1'
ID547368
Institutional Source Beutler Lab
Gene Symbol Fam71f1
Ensembl Gene ENSMUSG00000039742
Gene Namefamily with sequence similarity 71, member F1
SynonymsLOC330277
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R7047 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location29319140-29336019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29323810 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 178 (L178H)
Ref Sequence ENSEMBL: ENSMUSP00000132703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090487] [ENSMUST00000163229] [ENSMUST00000164560] [ENSMUST00000166462]
Predicted Effect probably damaging
Transcript: ENSMUST00000090487
AA Change: L178H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087973
Gene: ENSMUSG00000039742
AA Change: L178H

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
Pfam:DUF3699 136 210 5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163229
SMART Domains Protein: ENSMUSP00000132402
Gene: ENSMUSG00000039742

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164560
AA Change: L178H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126496
Gene: ENSMUSG00000039742
AA Change: L178H

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
Pfam:DUF3699 137 208 7e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166462
AA Change: L178H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132703
Gene: ENSMUSG00000039742
AA Change: L178H

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
Pfam:DUF3699 136 210 3.1e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,660,174 I1278N possibly damaging Het
Adcy5 T A 16: 35,267,215 L482Q probably damaging Het
Adora2a A G 10: 75,326,311 I95V probably damaging Het
Anapc1 A C 2: 128,615,430 C1887G probably damaging Het
Arfgef2 T A 2: 166,851,945 probably null Het
Capn11 G T 17: 45,638,696 S448* probably null Het
Capn7 C T 14: 31,336,685 probably benign Het
Cep55 T A 19: 38,060,091 V65D possibly damaging Het
Col5a1 A G 2: 27,928,084 K107R unknown Het
Dbh T A 2: 27,165,610 I32N possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dzip3 A T 16: 48,982,126 N13K probably benign Het
Emilin1 A G 5: 30,917,078 N221S probably benign Het
Ext2 A G 2: 93,739,657 F470L probably damaging Het
Filip1 T A 9: 79,853,634 Q206L probably damaging Het
Gpr63 G T 4: 25,007,320 A15S probably benign Het
Grhl3 T C 4: 135,549,240 probably null Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Ift172 G T 5: 31,275,894 Y193* probably null Het
Ints1 A C 5: 139,758,471 L1512* probably null Het
Kat2b A G 17: 53,663,569 Q661R probably benign Het
Kat6a A G 8: 22,938,538 N1303S possibly damaging Het
L3mbtl4 G T 17: 68,461,566 R223L probably benign Het
Maml2 T C 9: 13,620,881 probably benign Het
Mixl1 A G 1: 180,696,618 probably null Het
Mocs1 T C 17: 49,452,859 probably null Het
Ms4a15 T G 19: 10,984,872 N36T probably damaging Het
Msr1 G A 8: 39,642,616 T2I possibly damaging Het
Nlgn1 A C 3: 25,436,035 Y509* probably null Het
Nsmce1 C A 7: 125,491,434 G4C probably benign Het
Olfr1218 A T 2: 89,055,146 F93L probably damaging Het
Olfr621-ps1 A G 7: 103,629,711 V83A probably damaging Het
Pan3 G A 5: 147,546,365 G452D probably damaging Het
Pcyox1 G T 6: 86,388,909 P441H probably damaging Het
Phf12 T C 11: 78,013,273 V273A probably damaging Het
Plcd4 A G 1: 74,551,989 E181G possibly damaging Het
Ptgfr A T 3: 151,835,541 I110N possibly damaging Het
Rab40c A C 17: 25,919,484 V8G probably damaging Het
Rasal3 T A 17: 32,396,484 Y460F probably damaging Het
Rhbdf2 A G 11: 116,603,651 probably null Het
Ryr2 T A 13: 11,824,400 N496Y possibly damaging Het
Sacs A T 14: 61,213,002 I4166F probably damaging Het
Sh2d3c T C 2: 32,721,160 M1T probably null Het
Smarca2 C T 19: 26,669,155 S651L possibly damaging Het
Sned1 A T 1: 93,285,818 R1204S possibly damaging Het
Spata31d1b T C 13: 59,712,435 Y41H probably damaging Het
Stab2 C T 10: 86,858,152 C2075Y probably damaging Het
Tcte1 A T 17: 45,533,368 Q90L possibly damaging Het
Tll2 C T 19: 41,086,240 G945S probably damaging Het
Tmbim7 A T 5: 3,670,112 T116S probably benign Het
Tnfrsf19 A T 14: 61,005,218 C72* probably null Het
Usp17le T A 7: 104,768,433 T501S probably benign Het
Wnt5b T A 6: 119,448,256 probably benign Het
Other mutations in Fam71f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Fam71f1 APN 6 29320701 missense probably damaging 0.99
IGL02342:Fam71f1 APN 6 29323830 missense possibly damaging 0.87
R0402:Fam71f1 UTSW 6 29323902 missense probably benign 0.01
R0467:Fam71f1 UTSW 6 29326607 missense probably damaging 1.00
R0610:Fam71f1 UTSW 6 29326577 missense probably benign 0.01
R1773:Fam71f1 UTSW 6 29334153 missense possibly damaging 0.83
R1950:Fam71f1 UTSW 6 29335816 utr 3 prime probably null
R4259:Fam71f1 UTSW 6 29320801 missense probably damaging 1.00
R4305:Fam71f1 UTSW 6 29326612 missense probably damaging 1.00
R4351:Fam71f1 UTSW 6 29320801 missense probably damaging 1.00
R4508:Fam71f1 UTSW 6 29323765 missense probably benign 0.04
R5014:Fam71f1 UTSW 6 29326724 intron probably benign
R5249:Fam71f1 UTSW 6 29323897 missense probably damaging 1.00
R5506:Fam71f1 UTSW 6 29319298 missense probably damaging 1.00
R6212:Fam71f1 UTSW 6 29319374 missense probably damaging 1.00
R6456:Fam71f1 UTSW 6 29334046 missense probably benign
R6949:Fam71f1 UTSW 6 29323906 missense probably damaging 1.00
R7562:Fam71f1 UTSW 6 29323834 missense probably damaging 1.00
X0065:Fam71f1 UTSW 6 29326661 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCCATCCTTGAAGAGACG -3'
(R):5'- TACACAGGACTCTCAGCAGCAG -3'

Sequencing Primer
(F):5'- TCCTTGAAGAGACGCACCAG -3'
(R):5'- CTCCAAATCTGATCTTGGCTGAAGAC -3'
Posted On2019-05-13