Incidental Mutation 'R7047:Tnfrsf19'
ID547386
Institutional Source Beutler Lab
Gene Symbol Tnfrsf19
Ensembl Gene ENSMUSG00000060548
Gene Nametumor necrosis factor receptor superfamily, member 19
SynonymsTRADE, Troy, TAJ-ALPHA, TAJ
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7047 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location60963875-61046490 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 61005218 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 72 (C72*)
Ref Sequence ENSEMBL: ENSMUSP00000152920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111234] [ENSMUST00000111236] [ENSMUST00000224371] [ENSMUST00000225730]
Predicted Effect probably null
Transcript: ENSMUST00000111234
AA Change: C72*
SMART Domains Protein: ENSMUSP00000106865
Gene: ENSMUSG00000060548
AA Change: C72*

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TNFR 34 72 1.75e0 SMART
TNFR 75 114 3.32e-1 SMART
transmembrane domain 169 191 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111236
AA Change: C72*
SMART Domains Protein: ENSMUSP00000106867
Gene: ENSMUSG00000060548
AA Change: C72*

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TNFR 34 72 1.75e0 SMART
TNFR 75 114 3.32e-1 SMART
transmembrane domain 169 191 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000224371
AA Change: C72*
Predicted Effect probably null
Transcript: ENSMUST00000225730
AA Change: C72*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is highly expressed during embryonic development. It has been shown to interact with TRAF family members, and to activate JNK signaling pathway when overexpressed in cells. This receptor is capable of inducing apoptosis by a caspase-independent mechanism, and it is thought to play an essential role in embryonic development. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit no obvious physical abnormalities or alterations in behavior, locomotion, or fecundity, however neurons are more resistant to the suppressive action of myelin inhibitors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,660,174 I1278N possibly damaging Het
Adcy5 T A 16: 35,267,215 L482Q probably damaging Het
Adora2a A G 10: 75,326,311 I95V probably damaging Het
Anapc1 A C 2: 128,615,430 C1887G probably damaging Het
Arfgef2 T A 2: 166,851,945 probably null Het
Capn11 G T 17: 45,638,696 S448* probably null Het
Capn7 C T 14: 31,336,685 probably benign Het
Cep55 T A 19: 38,060,091 V65D possibly damaging Het
Col5a1 A G 2: 27,928,084 K107R unknown Het
Dbh T A 2: 27,165,610 I32N possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dzip3 A T 16: 48,982,126 N13K probably benign Het
Emilin1 A G 5: 30,917,078 N221S probably benign Het
Ext2 A G 2: 93,739,657 F470L probably damaging Het
Fam71f1 T A 6: 29,323,810 L178H probably damaging Het
Filip1 T A 9: 79,853,634 Q206L probably damaging Het
Gpr63 G T 4: 25,007,320 A15S probably benign Het
Grhl3 T C 4: 135,549,240 probably null Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Ift172 G T 5: 31,275,894 Y193* probably null Het
Ints1 A C 5: 139,758,471 L1512* probably null Het
Kat2b A G 17: 53,663,569 Q661R probably benign Het
Kat6a A G 8: 22,938,538 N1303S possibly damaging Het
L3mbtl4 G T 17: 68,461,566 R223L probably benign Het
Maml2 T C 9: 13,620,881 probably benign Het
Mixl1 A G 1: 180,696,618 probably null Het
Mocs1 T C 17: 49,452,859 probably null Het
Ms4a15 T G 19: 10,984,872 N36T probably damaging Het
Msr1 G A 8: 39,642,616 T2I possibly damaging Het
Nlgn1 A C 3: 25,436,035 Y509* probably null Het
Nsmce1 C A 7: 125,491,434 G4C probably benign Het
Olfr1218 A T 2: 89,055,146 F93L probably damaging Het
Olfr621-ps1 A G 7: 103,629,711 V83A probably damaging Het
Pan3 G A 5: 147,546,365 G452D probably damaging Het
Pcyox1 G T 6: 86,388,909 P441H probably damaging Het
Phf12 T C 11: 78,013,273 V273A probably damaging Het
Plcd4 A G 1: 74,551,989 E181G possibly damaging Het
Ptgfr A T 3: 151,835,541 I110N possibly damaging Het
Rab40c A C 17: 25,919,484 V8G probably damaging Het
Rasal3 T A 17: 32,396,484 Y460F probably damaging Het
Rhbdf2 A G 11: 116,603,651 probably null Het
Ryr2 T A 13: 11,824,400 N496Y possibly damaging Het
Sacs A T 14: 61,213,002 I4166F probably damaging Het
Sh2d3c T C 2: 32,721,160 M1T probably null Het
Smarca2 C T 19: 26,669,155 S651L possibly damaging Het
Sned1 A T 1: 93,285,818 R1204S possibly damaging Het
Spata31d1b T C 13: 59,712,435 Y41H probably damaging Het
Stab2 C T 10: 86,858,152 C2075Y probably damaging Het
Tcte1 A T 17: 45,533,368 Q90L possibly damaging Het
Tll2 C T 19: 41,086,240 G945S probably damaging Het
Tmbim7 A T 5: 3,670,112 T116S probably benign Het
Usp17le T A 7: 104,768,433 T501S probably benign Het
Wnt5b T A 6: 119,448,256 probably benign Het
Other mutations in Tnfrsf19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Tnfrsf19 APN 14 61024182 missense possibly damaging 0.53
IGL01564:Tnfrsf19 APN 14 60974609 missense possibly damaging 0.85
IGL01878:Tnfrsf19 APN 14 60996644 missense probably damaging 0.98
IGL02220:Tnfrsf19 APN 14 60973492 unclassified probably benign
IGL02378:Tnfrsf19 APN 14 60971002 missense probably benign 0.00
IGL02546:Tnfrsf19 APN 14 60973538 missense possibly damaging 0.86
IGL02583:Tnfrsf19 APN 14 61024210 missense probably damaging 0.98
IGL03037:Tnfrsf19 APN 14 61024272 missense possibly damaging 0.83
IGL03221:Tnfrsf19 APN 14 61024778 missense probably benign 0.06
R0241:Tnfrsf19 UTSW 14 60973592 missense possibly damaging 0.93
R0373:Tnfrsf19 UTSW 14 60972036 missense possibly damaging 0.47
R1521:Tnfrsf19 UTSW 14 61005106 missense probably damaging 0.99
R3038:Tnfrsf19 UTSW 14 60972063 missense probably benign
R4346:Tnfrsf19 UTSW 14 60971980 critical splice donor site probably null
R4997:Tnfrsf19 UTSW 14 60971209 missense probably benign
R5756:Tnfrsf19 UTSW 14 61024775 missense probably benign
R5869:Tnfrsf19 UTSW 14 60971178 missense possibly damaging 0.70
R6110:Tnfrsf19 UTSW 14 60971139 missense probably benign 0.08
R7266:Tnfrsf19 UTSW 14 60974698 missense possibly damaging 0.91
R7491:Tnfrsf19 UTSW 14 61005205 missense possibly damaging 0.75
R7729:Tnfrsf19 UTSW 14 60974734 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- AAAGAGAAGTCATGGCCCTAC -3'
(R):5'- AAAGTGGATTGCTAAGGACCC -3'

Sequencing Primer
(F):5'- GAGAAGTCATGGCCCTACTCACC -3'
(R):5'- ATTGCTAAGGACCCTTGCG -3'
Posted On2019-05-13