Incidental Mutation 'R7047:Dzip3'
ID547389
Institutional Source Beutler Lab
Gene Symbol Dzip3
Ensembl Gene ENSMUSG00000064061
Gene NameDAZ interacting protein 3, zinc finger
Synonyms2A-HUB, 6430549P11Rik, 2310047C04Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001110017.1, NM_027341.2; Ensembl: ENSMUST00000121869

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7047 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location48924232-48994165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48982126 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 13 (N13K)
Ref Sequence ENSEMBL: ENSMUSP00000110161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114516] [ENSMUST00000121869]
Predicted Effect probably benign
Transcript: ENSMUST00000114516
AA Change: N13K

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000110161
Gene: ENSMUSG00000064061
AA Change: N13K

DomainStartEndE-ValueType
low complexity region 451 472 N/A INTRINSIC
coiled coil region 548 568 N/A INTRINSIC
coiled coil region 599 650 N/A INTRINSIC
low complexity region 743 754 N/A INTRINSIC
low complexity region 883 891 N/A INTRINSIC
RING 938 977 2.09e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121869
AA Change: N13K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000113344
Gene: ENSMUSG00000064061
AA Change: N13K

DomainStartEndE-ValueType
low complexity region 657 678 N/A INTRINSIC
coiled coil region 754 774 N/A INTRINSIC
coiled coil region 805 856 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 1089 1097 N/A INTRINSIC
RING 1144 1183 2.09e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (53/54)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-indcued allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,660,174 I1278N possibly damaging Het
Adcy5 T A 16: 35,267,215 L482Q probably damaging Het
Adora2a A G 10: 75,326,311 I95V probably damaging Het
Anapc1 A C 2: 128,615,430 C1887G probably damaging Het
Arfgef2 T A 2: 166,851,945 probably null Het
Capn11 G T 17: 45,638,696 S448* probably null Het
Capn7 C T 14: 31,336,685 probably benign Het
Cep55 T A 19: 38,060,091 V65D possibly damaging Het
Col5a1 A G 2: 27,928,084 K107R unknown Het
Dbh T A 2: 27,165,610 I32N possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Emilin1 A G 5: 30,917,078 N221S probably benign Het
Ext2 A G 2: 93,739,657 F470L probably damaging Het
Fam71f1 T A 6: 29,323,810 L178H probably damaging Het
Filip1 T A 9: 79,853,634 Q206L probably damaging Het
Gpr63 G T 4: 25,007,320 A15S probably benign Het
Grhl3 T C 4: 135,549,240 probably null Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Ift172 G T 5: 31,275,894 Y193* probably null Het
Ints1 A C 5: 139,758,471 L1512* probably null Het
Kat2b A G 17: 53,663,569 Q661R probably benign Het
Kat6a A G 8: 22,938,538 N1303S possibly damaging Het
L3mbtl4 G T 17: 68,461,566 R223L probably benign Het
Maml2 T C 9: 13,620,881 probably benign Het
Mixl1 A G 1: 180,696,618 probably null Het
Mocs1 T C 17: 49,452,859 probably null Het
Ms4a15 T G 19: 10,984,872 N36T probably damaging Het
Msr1 G A 8: 39,642,616 T2I possibly damaging Het
Nlgn1 A C 3: 25,436,035 Y509* probably null Het
Nsmce1 C A 7: 125,491,434 G4C probably benign Het
Olfr1218 A T 2: 89,055,146 F93L probably damaging Het
Olfr621-ps1 A G 7: 103,629,711 V83A probably damaging Het
Pan3 G A 5: 147,546,365 G452D probably damaging Het
Pcyox1 G T 6: 86,388,909 P441H probably damaging Het
Phf12 T C 11: 78,013,273 V273A probably damaging Het
Plcd4 A G 1: 74,551,989 E181G possibly damaging Het
Ptgfr A T 3: 151,835,541 I110N possibly damaging Het
Rab40c A C 17: 25,919,484 V8G probably damaging Het
Rasal3 T A 17: 32,396,484 Y460F probably damaging Het
Rhbdf2 A G 11: 116,603,651 probably null Het
Ryr2 T A 13: 11,824,400 N496Y possibly damaging Het
Sacs A T 14: 61,213,002 I4166F probably damaging Het
Sh2d3c T C 2: 32,721,160 M1T probably null Het
Smarca2 C T 19: 26,669,155 S651L possibly damaging Het
Sned1 A T 1: 93,285,818 R1204S possibly damaging Het
Spata31d1b T C 13: 59,712,435 Y41H probably damaging Het
Stab2 C T 10: 86,858,152 C2075Y probably damaging Het
Tcte1 A T 17: 45,533,368 Q90L possibly damaging Het
Tll2 C T 19: 41,086,240 G945S probably damaging Het
Tmbim7 A T 5: 3,670,112 T116S probably benign Het
Tnfrsf19 A T 14: 61,005,218 C72* probably null Het
Usp17le T A 7: 104,768,433 T501S probably benign Het
Wnt5b T A 6: 119,448,256 probably benign Het
Other mutations in Dzip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Dzip3 APN 16 48928415 missense probably damaging 1.00
IGL00931:Dzip3 APN 16 48935497 critical splice donor site probably null
IGL01109:Dzip3 APN 16 48929674 missense probably benign 0.27
IGL01121:Dzip3 APN 16 48944881 missense probably benign 0.10
IGL01328:Dzip3 APN 16 48972258 missense probably damaging 1.00
IGL01729:Dzip3 APN 16 48928363 missense possibly damaging 0.78
IGL02044:Dzip3 APN 16 48948427 missense possibly damaging 0.90
IGL02051:Dzip3 APN 16 48972254 missense probably benign 0.01
IGL02115:Dzip3 APN 16 48948485 missense probably benign 0.00
IGL02125:Dzip3 APN 16 48927596 missense probably damaging 1.00
IGL02136:Dzip3 APN 16 48927582 missense possibly damaging 0.94
IGL02244:Dzip3 APN 16 48980988 missense probably benign 0.01
IGL02253:Dzip3 APN 16 48944924 missense probably benign 0.34
IGL02412:Dzip3 APN 16 48958457 missense probably benign 0.00
IGL02452:Dzip3 APN 16 48938537 splice site probably benign
IGL02481:Dzip3 APN 16 48975551 splice site probably benign
IGL02499:Dzip3 APN 16 48933850 missense probably damaging 1.00
IGL02511:Dzip3 APN 16 48936980 missense possibly damaging 0.75
IGL02519:Dzip3 APN 16 48928396 missense probably damaging 1.00
IGL02610:Dzip3 APN 16 48951653 missense probably damaging 1.00
IGL03129:Dzip3 APN 16 48942083 missense possibly damaging 0.51
IGL03342:Dzip3 APN 16 48929623 missense probably damaging 0.98
IGL03493:Dzip3 APN 16 48951696 missense probably benign 0.32
dazwick UTSW 16 48958465 missense possibly damaging 0.90
1mM(1):Dzip3 UTSW 16 48951557 missense probably damaging 1.00
PIT4651001:Dzip3 UTSW 16 48944878 missense probably benign
R0313:Dzip3 UTSW 16 48937061 missense probably damaging 0.99
R0483:Dzip3 UTSW 16 48947713 missense possibly damaging 0.94
R0504:Dzip3 UTSW 16 48959643 splice site probably benign
R0744:Dzip3 UTSW 16 48959675 missense probably damaging 1.00
R0800:Dzip3 UTSW 16 48953808 splice site probably benign
R0927:Dzip3 UTSW 16 48975477 missense probably damaging 0.99
R0931:Dzip3 UTSW 16 48951558 missense probably damaging 1.00
R1170:Dzip3 UTSW 16 48961208 missense probably damaging 1.00
R1203:Dzip3 UTSW 16 48951817 missense probably damaging 1.00
R1205:Dzip3 UTSW 16 48951681 missense probably damaging 1.00
R1442:Dzip3 UTSW 16 48945622 missense probably benign 0.19
R1526:Dzip3 UTSW 16 48937006 missense probably damaging 1.00
R1560:Dzip3 UTSW 16 48951540 splice site probably null
R1585:Dzip3 UTSW 16 48977878 splice site probably benign
R1682:Dzip3 UTSW 16 48958417 critical splice donor site probably null
R1957:Dzip3 UTSW 16 48927593 missense probably damaging 1.00
R2472:Dzip3 UTSW 16 48953787 missense possibly damaging 0.85
R2571:Dzip3 UTSW 16 48972218 splice site probably null
R3040:Dzip3 UTSW 16 48928324 missense probably damaging 1.00
R3081:Dzip3 UTSW 16 48927558 missense probably damaging 1.00
R3615:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3616:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3786:Dzip3 UTSW 16 48975543 missense probably benign 0.08
R3851:Dzip3 UTSW 16 48950013 missense possibly damaging 0.94
R4097:Dzip3 UTSW 16 48958489 nonsense probably null
R4371:Dzip3 UTSW 16 48943455 critical splice donor site probably null
R4612:Dzip3 UTSW 16 48952040 nonsense probably null
R4671:Dzip3 UTSW 16 48979590 nonsense probably null
R4695:Dzip3 UTSW 16 48951561 missense probably damaging 1.00
R4696:Dzip3 UTSW 16 48925969 unclassified probably benign
R4769:Dzip3 UTSW 16 48938474 missense probably damaging 0.97
R5063:Dzip3 UTSW 16 48953754 nonsense probably null
R5321:Dzip3 UTSW 16 48957675 missense possibly damaging 0.95
R5764:Dzip3 UTSW 16 48927361 intron probably benign
R6020:Dzip3 UTSW 16 48951842 missense probably damaging 1.00
R6218:Dzip3 UTSW 16 48958465 missense possibly damaging 0.90
R6300:Dzip3 UTSW 16 48951807 missense probably damaging 1.00
R6365:Dzip3 UTSW 16 48931273 missense probably damaging 0.96
R6778:Dzip3 UTSW 16 48982083 missense probably benign 0.00
R6915:Dzip3 UTSW 16 48942125 missense possibly damaging 0.72
R7059:Dzip3 UTSW 16 48980942 missense probably benign 0.34
R7095:Dzip3 UTSW 16 48927790 missense probably benign
R7227:Dzip3 UTSW 16 48951569 missense probably damaging 0.99
R7319:Dzip3 UTSW 16 48927540 critical splice donor site probably null
R7436:Dzip3 UTSW 16 48951989 missense probably damaging 1.00
R7469:Dzip3 UTSW 16 48944879 missense probably benign
R7526:Dzip3 UTSW 16 48975474 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGTGAGTTATGCCCAAAATTG -3'
(R):5'- TTCTCTACCATCATCAAGCAAGAG -3'

Sequencing Primer
(F):5'- CACTTTTTCAGAAAGTGACTTAG -3'
(R):5'- GCAAGAGCTTAGTATAACTGTTCTC -3'
Posted On2019-05-13