Mutagenetix > Incidental Mutations

Incidental Mutation 'R7047:Dzip3'

547389

Institutional Source

Beutler Lab

Gene Symbol

Dzip3

Ensembl Gene

ENSMUSG00000064061

Gene Name

DAZ interacting protein 3, zinc finger

Synonyms

2A-HUB, 6430549P11Rik, 2310047C04Rik

MMRRC Submission

Accession Numbers

Genbank: NM_001110017.1, NM_027341.2; Ensembl: ENSMUST00000121869

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7047 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

48924232-48994165 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 48982126 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 13 (N13K)

Ref Sequence

ENSEMBL: ENSMUSP00000110161 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114516] [ENSMUST00000121869]

Predicted Effect

probably benign
Transcript: ENSMUST00000114516
AA Change: N13K

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000110161
Gene: ENSMUSG00000064061
AA Change: N13K

Domain	Start	End	E-Value	Type
low complexity region	451	472	N/A	INTRINSIC
coiled coil region	548	568	N/A	INTRINSIC
coiled coil region	599	650	N/A	INTRINSIC
low complexity region	743	754	N/A	INTRINSIC
low complexity region	883	891	N/A	INTRINSIC
RING	938	977	2.09e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000121869
AA Change: N13K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000113344
Gene: ENSMUSG00000064061
AA Change: N13K

Domain	Start	End	E-Value	Type
low complexity region	657	678	N/A	INTRINSIC
coiled coil region	754	774	N/A	INTRINSIC
coiled coil region	805	856	N/A	INTRINSIC
low complexity region	949	960	N/A	INTRINSIC
low complexity region	1089	1097	N/A	INTRINSIC
RING	1144	1183	2.09e-7	SMART

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (53/54)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-indcued allele exhibit embryonic lethality. [provided by MGI curators]

Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	T	14: 32,660,174	I1278N	possibly damaging	Het
Adcy5	T	A	16: 35,267,215	L482Q	probably damaging	Het
Adora2a	A	G	10: 75,326,311	I95V	probably damaging	Het
Anapc1	A	C	2: 128,615,430	C1887G	probably damaging	Het
Arfgef2	T	A	2: 166,851,945		probably null	Het
Capn11	G	T	17: 45,638,696	S448*	probably null	Het
Capn7	C	T	14: 31,336,685		probably benign	Het
Cep55	T	A	19: 38,060,091	V65D	possibly damaging	Het
Col5a1	A	G	2: 27,928,084	K107R	unknown	Het
Dbh	T	A	2: 27,165,610	I32N	possibly damaging	Het
Disp1	C	A	1: 183,087,466	R1130L	probably damaging	Het
Emilin1	A	G	5: 30,917,078	N221S	probably benign	Het
Ext2	A	G	2: 93,739,657	F470L	probably damaging	Het
Fam71f1	T	A	6: 29,323,810	L178H	probably damaging	Het
Filip1	T	A	9: 79,853,634	Q206L	probably damaging	Het
Gpr63	G	T	4: 25,007,320	A15S	probably benign	Het
Grhl3	T	C	4: 135,549,240		probably null	Het
Hspa5	C	T	2: 34,773,192	P127L	probably damaging	Het
Ift172	G	T	5: 31,275,894	Y193*	probably null	Het
Ints1	A	C	5: 139,758,471	L1512*	probably null	Het
Kat2b	A	G	17: 53,663,569	Q661R	probably benign	Het
Kat6a	A	G	8: 22,938,538	N1303S	possibly damaging	Het
L3mbtl4	G	T	17: 68,461,566	R223L	probably benign	Het
Maml2	T	C	9: 13,620,881		probably benign	Het
Mixl1	A	G	1: 180,696,618		probably null	Het
Mocs1	T	C	17: 49,452,859		probably null	Het
Ms4a15	T	G	19: 10,984,872	N36T	probably damaging	Het
Msr1	G	A	8: 39,642,616	T2I	possibly damaging	Het
Nlgn1	A	C	3: 25,436,035	Y509*	probably null	Het
Nsmce1	C	A	7: 125,491,434	G4C	probably benign	Het
Olfr1218	A	T	2: 89,055,146	F93L	probably damaging	Het
Olfr621-ps1	A	G	7: 103,629,711	V83A	probably damaging	Het
Pan3	G	A	5: 147,546,365	G452D	probably damaging	Het
Pcyox1	G	T	6: 86,388,909	P441H	probably damaging	Het
Phf12	T	C	11: 78,013,273	V273A	probably damaging	Het
Plcd4	A	G	1: 74,551,989	E181G	possibly damaging	Het
Ptgfr	A	T	3: 151,835,541	I110N	possibly damaging	Het
Rab40c	A	C	17: 25,919,484	V8G	probably damaging	Het
Rasal3	T	A	17: 32,396,484	Y460F	probably damaging	Het
Rhbdf2	A	G	11: 116,603,651		probably null	Het
Ryr2	T	A	13: 11,824,400	N496Y	possibly damaging	Het
Sacs	A	T	14: 61,213,002	I4166F	probably damaging	Het
Sh2d3c	T	C	2: 32,721,160	M1T	probably null	Het
Smarca2	C	T	19: 26,669,155	S651L	possibly damaging	Het
Sned1	A	T	1: 93,285,818	R1204S	possibly damaging	Het
Spata31d1b	T	C	13: 59,712,435	Y41H	probably damaging	Het
Stab2	C	T	10: 86,858,152	C2075Y	probably damaging	Het
Tcte1	A	T	17: 45,533,368	Q90L	possibly damaging	Het
Tll2	C	T	19: 41,086,240	G945S	probably damaging	Het
Tmbim7	A	T	5: 3,670,112	T116S	probably benign	Het
Tnfrsf19	A	T	14: 61,005,218	C72*	probably null	Het
Usp17le	T	A	7: 104,768,433	T501S	probably benign	Het
Wnt5b	T	A	6: 119,448,256		probably benign	Het

Other mutations in Dzip3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00825:Dzip3	APN	16	48928415	missense	probably damaging	1.00
IGL00931:Dzip3	APN	16	48935497	critical splice donor site	probably null
IGL01109:Dzip3	APN	16	48929674	missense	probably benign	0.27
IGL01121:Dzip3	APN	16	48944881	missense	probably benign	0.10
IGL01328:Dzip3	APN	16	48972258	missense	probably damaging	1.00
IGL01729:Dzip3	APN	16	48928363	missense	possibly damaging	0.78
IGL02044:Dzip3	APN	16	48948427	missense	possibly damaging	0.90
IGL02051:Dzip3	APN	16	48972254	missense	probably benign	0.01
IGL02115:Dzip3	APN	16	48948485	missense	probably benign	0.00
IGL02125:Dzip3	APN	16	48927596	missense	probably damaging	1.00
IGL02136:Dzip3	APN	16	48927582	missense	possibly damaging	0.94
IGL02244:Dzip3	APN	16	48980988	missense	probably benign	0.01
IGL02253:Dzip3	APN	16	48944924	missense	probably benign	0.34
IGL02412:Dzip3	APN	16	48958457	missense	probably benign	0.00
IGL02452:Dzip3	APN	16	48938537	splice site	probably benign
IGL02481:Dzip3	APN	16	48975551	splice site	probably benign
IGL02499:Dzip3	APN	16	48933850	missense	probably damaging	1.00
IGL02511:Dzip3	APN	16	48936980	missense	possibly damaging	0.75
IGL02519:Dzip3	APN	16	48928396	missense	probably damaging	1.00
IGL02610:Dzip3	APN	16	48951653	missense	probably damaging	1.00
IGL03129:Dzip3	APN	16	48942083	missense	possibly damaging	0.51
IGL03342:Dzip3	APN	16	48929623	missense	probably damaging	0.98
IGL03493:Dzip3	APN	16	48951696	missense	probably benign	0.32
corvette	UTSW	16	48927540	critical splice donor site	probably null
dazwick	UTSW	16	48958465	missense	possibly damaging	0.90
1mM(1):Dzip3	UTSW	16	48951557	missense	probably damaging	1.00
PIT4651001:Dzip3	UTSW	16	48944878	missense	probably benign
R0313:Dzip3	UTSW	16	48937061	missense	probably damaging	0.99
R0483:Dzip3	UTSW	16	48947713	missense	possibly damaging	0.94
R0504:Dzip3	UTSW	16	48959643	splice site	probably benign
R0744:Dzip3	UTSW	16	48959675	missense	probably damaging	1.00
R0800:Dzip3	UTSW	16	48953808	splice site	probably benign
R0927:Dzip3	UTSW	16	48975477	missense	probably damaging	0.99
R0931:Dzip3	UTSW	16	48951558	missense	probably damaging	1.00
R1170:Dzip3	UTSW	16	48961208	missense	probably damaging	1.00
R1203:Dzip3	UTSW	16	48951817	missense	probably damaging	1.00
R1205:Dzip3	UTSW	16	48951681	missense	probably damaging	1.00
R1442:Dzip3	UTSW	16	48945622	missense	probably benign	0.19
R1526:Dzip3	UTSW	16	48937006	missense	probably damaging	1.00
R1560:Dzip3	UTSW	16	48951540	splice site	probably null
R1585:Dzip3	UTSW	16	48977878	splice site	probably benign
R1682:Dzip3	UTSW	16	48958417	critical splice donor site	probably null
R1957:Dzip3	UTSW	16	48927593	missense	probably damaging	1.00
R2472:Dzip3	UTSW	16	48953787	missense	possibly damaging	0.85
R2571:Dzip3	UTSW	16	48972218	splice site	probably null
R3040:Dzip3	UTSW	16	48928324	missense	probably damaging	1.00
R3081:Dzip3	UTSW	16	48927558	missense	probably damaging	1.00
R3615:Dzip3	UTSW	16	48937063	missense	probably damaging	1.00
R3616:Dzip3	UTSW	16	48937063	missense	probably damaging	1.00
R3786:Dzip3	UTSW	16	48975543	missense	probably benign	0.08
R3851:Dzip3	UTSW	16	48950013	missense	possibly damaging	0.94
R4097:Dzip3	UTSW	16	48958489	nonsense	probably null
R4371:Dzip3	UTSW	16	48943455	critical splice donor site	probably null
R4612:Dzip3	UTSW	16	48952040	nonsense	probably null
R4671:Dzip3	UTSW	16	48979590	nonsense	probably null
R4695:Dzip3	UTSW	16	48951561	missense	probably damaging	1.00
R4696:Dzip3	UTSW	16	48925969	unclassified	probably benign
R4769:Dzip3	UTSW	16	48938474	missense	probably damaging	0.97
R5063:Dzip3	UTSW	16	48953754	nonsense	probably null
R5321:Dzip3	UTSW	16	48957675	missense	possibly damaging	0.95
R5764:Dzip3	UTSW	16	48927361	intron	probably benign
R6020:Dzip3	UTSW	16	48951842	missense	probably damaging	1.00
R6218:Dzip3	UTSW	16	48958465	missense	possibly damaging	0.90
R6300:Dzip3	UTSW	16	48951807	missense	probably damaging	1.00
R6365:Dzip3	UTSW	16	48931273	missense	probably damaging	0.96
R6778:Dzip3	UTSW	16	48982083	missense	probably benign	0.00
R6915:Dzip3	UTSW	16	48942125	missense	possibly damaging	0.72
R7059:Dzip3	UTSW	16	48980942	missense	probably benign	0.34
R7095:Dzip3	UTSW	16	48927790	missense	probably benign
R7227:Dzip3	UTSW	16	48951569	missense	probably damaging	0.99
R7319:Dzip3	UTSW	16	48927540	critical splice donor site	probably null
R7436:Dzip3	UTSW	16	48951989	missense	probably damaging	1.00
R7469:Dzip3	UTSW	16	48944879	missense	probably benign
R7526:Dzip3	UTSW	16	48975474	missense	probably damaging	0.99
R7964:Dzip3	UTSW	16	48951905	missense	probably damaging	1.00
R8131:Dzip3	UTSW	16	48933793	critical splice donor site	probably null
R8188:Dzip3	UTSW	16	48952136	missense	probably damaging	1.00
R8209:Dzip3	UTSW	16	48977944	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTGAGTTATGCCCAAAATTG -3'
(R):5'- TTCTCTACCATCATCAAGCAAGAG -3'

Sequencing Primer
(F):5'- CACTTTTTCAGAAAGTGACTTAG -3'
(R):5'- GCAAGAGCTTAGTATAACTGTTCTC -3'

Posted On

2019-05-13