Incidental Mutation 'R7047:Capn11'
ID547393
Institutional Source Beutler Lab
Gene Symbol Capn11
Ensembl Gene ENSMUSG00000058626
Gene Namecalpain 11
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7047 (G1)
Quality Score197.009
Status Not validated
Chromosome17
Chromosomal Location45630204-45659325 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 45638696 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 448 (S448*)
Ref Sequence ENSEMBL: ENSMUSP00000113132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120717] [ENSMUST00000151350]
Predicted Effect probably null
Transcript: ENSMUST00000120717
AA Change: S448*
SMART Domains Protein: ENSMUSP00000113132
Gene: ENSMUSG00000058626
AA Change: S448*

DomainStartEndE-ValueType
CysPc 37 362 2.75e-157 SMART
calpain_III 366 523 2.57e-84 SMART
EFh 590 618 3.91e-4 SMART
EFh 620 648 6.88e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151350
SMART Domains Protein: ENSMUSP00000119679
Gene: ENSMUSG00000058626

DomainStartEndE-ValueType
Pfam:Peptidase_C2 94 153 1.5e-14 PFAM
low complexity region 163 174 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains constitute a family of intracellular calcium-dependent cysteine proteases. There are eight members in this superfamily. They consist of a variable 80 kDa subunit and an invariant 30 kDa subunit. This calpain protein appears to have protease activity and calcium-binding ability. A similar mouse protein may play a functional role in spermatogenesis and in the regulation of calcium-dependent signal transduction events during meiosis. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,660,174 I1278N possibly damaging Het
Adcy5 T A 16: 35,267,215 L482Q probably damaging Het
Adora2a A G 10: 75,326,311 I95V probably damaging Het
Anapc1 A C 2: 128,615,430 C1887G probably damaging Het
Arfgef2 T A 2: 166,851,945 probably null Het
Capn7 C T 14: 31,336,685 probably benign Het
Cep55 T A 19: 38,060,091 V65D possibly damaging Het
Col5a1 A G 2: 27,928,084 K107R unknown Het
Dbh T A 2: 27,165,610 I32N possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dzip3 A T 16: 48,982,126 N13K probably benign Het
Emilin1 A G 5: 30,917,078 N221S probably benign Het
Ext2 A G 2: 93,739,657 F470L probably damaging Het
Fam71f1 T A 6: 29,323,810 L178H probably damaging Het
Filip1 T A 9: 79,853,634 Q206L probably damaging Het
Gpr63 G T 4: 25,007,320 A15S probably benign Het
Grhl3 T C 4: 135,549,240 probably null Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Ift172 G T 5: 31,275,894 Y193* probably null Het
Ints1 A C 5: 139,758,471 L1512* probably null Het
Kat2b A G 17: 53,663,569 Q661R probably benign Het
Kat6a A G 8: 22,938,538 N1303S possibly damaging Het
L3mbtl4 G T 17: 68,461,566 R223L probably benign Het
Maml2 T C 9: 13,620,881 probably benign Het
Mixl1 A G 1: 180,696,618 probably null Het
Mocs1 T C 17: 49,452,859 probably null Het
Ms4a15 T G 19: 10,984,872 N36T probably damaging Het
Msr1 G A 8: 39,642,616 T2I possibly damaging Het
Nlgn1 A C 3: 25,436,035 Y509* probably null Het
Nsmce1 C A 7: 125,491,434 G4C probably benign Het
Olfr1218 A T 2: 89,055,146 F93L probably damaging Het
Olfr621-ps1 A G 7: 103,629,711 V83A probably damaging Het
Pan3 G A 5: 147,546,365 G452D probably damaging Het
Pcyox1 G T 6: 86,388,909 P441H probably damaging Het
Phf12 T C 11: 78,013,273 V273A probably damaging Het
Plcd4 A G 1: 74,551,989 E181G possibly damaging Het
Ptgfr A T 3: 151,835,541 I110N possibly damaging Het
Rab40c A C 17: 25,919,484 V8G probably damaging Het
Rasal3 T A 17: 32,396,484 Y460F probably damaging Het
Rhbdf2 A G 11: 116,603,651 probably null Het
Ryr2 T A 13: 11,824,400 N496Y possibly damaging Het
Sacs A T 14: 61,213,002 I4166F probably damaging Het
Sh2d3c T C 2: 32,721,160 M1T probably null Het
Smarca2 C T 19: 26,669,155 S651L possibly damaging Het
Sned1 A T 1: 93,285,818 R1204S possibly damaging Het
Spata31d1b T C 13: 59,712,435 Y41H probably damaging Het
Stab2 C T 10: 86,858,152 C2075Y probably damaging Het
Tcte1 A T 17: 45,533,368 Q90L possibly damaging Het
Tll2 C T 19: 41,086,240 G945S probably damaging Het
Tmbim7 A T 5: 3,670,112 T116S probably benign Het
Tnfrsf19 A T 14: 61,005,218 C72* probably null Het
Usp17le T A 7: 104,768,433 T501S probably benign Het
Wnt5b T A 6: 119,448,256 probably benign Het
Other mutations in Capn11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Capn11 APN 17 45643767 missense probably damaging 1.00
IGL01116:Capn11 APN 17 45638880 unclassified probably benign
IGL01121:Capn11 APN 17 45639132 missense probably benign 0.04
IGL01366:Capn11 APN 17 45653200 missense probably damaging 1.00
IGL01533:Capn11 APN 17 45632904 missense probably benign
IGL01595:Capn11 APN 17 45639434 missense probably benign 0.02
IGL02197:Capn11 APN 17 45639856 missense probably benign 0.14
IGL02683:Capn11 APN 17 45653591 missense probably damaging 1.00
IGL02696:Capn11 APN 17 45632709 missense probably damaging 1.00
IGL02711:Capn11 APN 17 45632415 missense probably damaging 1.00
IGL02900:Capn11 APN 17 45630614 splice site probably null
IGL03033:Capn11 APN 17 45642547 missense probably damaging 1.00
R0883:Capn11 UTSW 17 45638881 unclassified probably benign
R1494:Capn11 UTSW 17 45643809 missense probably damaging 1.00
R1735:Capn11 UTSW 17 45632401 nonsense probably null
R1785:Capn11 UTSW 17 45638697 missense probably benign 0.02
R1952:Capn11 UTSW 17 45642959 missense probably damaging 1.00
R2149:Capn11 UTSW 17 45633107 critical splice acceptor site probably null
R2397:Capn11 UTSW 17 45653221 missense probably damaging 1.00
R2495:Capn11 UTSW 17 45638763 missense probably damaging 0.97
R2516:Capn11 UTSW 17 45633799 missense probably damaging 0.98
R3934:Capn11 UTSW 17 45634287 splice site probably benign
R4016:Capn11 UTSW 17 45653756 missense probably damaging 1.00
R4226:Capn11 UTSW 17 45642466 critical splice donor site probably null
R4227:Capn11 UTSW 17 45642466 critical splice donor site probably null
R4774:Capn11 UTSW 17 45633080 missense probably benign 0.00
R4892:Capn11 UTSW 17 45633097 frame shift probably null
R5244:Capn11 UTSW 17 45633892 missense probably damaging 1.00
R5667:Capn11 UTSW 17 45639674 missense possibly damaging 0.87
R5671:Capn11 UTSW 17 45639674 missense possibly damaging 0.87
R5991:Capn11 UTSW 17 45659352 unclassified probably null
R6180:Capn11 UTSW 17 45630766 missense probably damaging 1.00
R6193:Capn11 UTSW 17 45653504 critical splice donor site probably null
R6774:Capn11 UTSW 17 45657330 intron probably benign
R7302:Capn11 UTSW 17 45643812 missense probably damaging 1.00
R7516:Capn11 UTSW 17 45638840 missense possibly damaging 0.95
R7563:Capn11 UTSW 17 45633965 missense probably damaging 0.99
R7718:Capn11 UTSW 17 45643781 missense probably damaging 1.00
R7999:Capn11 UTSW 17 45639206 missense probably damaging 1.00
R8058:Capn11 UTSW 17 45643755 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTTATCCTAGACTGGGGAG -3'
(R):5'- AACCACCTTGACCTGGATCTTC -3'

Sequencing Primer
(F):5'- ATCCTAGACTGGGGAGTTTGCC -3'
(R):5'- TGACCTGGATCTTCCACAGAG -3'
Posted On2019-05-13