Incidental Mutation 'R7047:Mocs1'
ID547394
Institutional Source Beutler Lab
Gene Symbol Mocs1
Ensembl Gene ENSMUSG00000064120
Gene Namemolybdenum cofactor synthesis 1
Synonyms3110045D15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7047 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location49428362-49455435 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 49452859 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024797] [ENSMUST00000024797] [ENSMUST00000173033] [ENSMUST00000173362] [ENSMUST00000174647]
Predicted Effect probably null
Transcript: ENSMUST00000024797
SMART Domains Protein: ENSMUSP00000024797
Gene: ENSMUSG00000064120

DomainStartEndE-ValueType
Elp3 70 273 1.63e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000024797
SMART Domains Protein: ENSMUSP00000024797
Gene: ENSMUSG00000064120

DomainStartEndE-ValueType
Elp3 70 273 1.63e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172871
SMART Domains Protein: ENSMUSP00000134449
Gene: ENSMUSG00000064120

DomainStartEndE-ValueType
Pfam:Mob_synth_C 1 86 8.6e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173033
SMART Domains Protein: ENSMUSP00000133694
Gene: ENSMUSG00000064120

DomainStartEndE-ValueType
Elp3 70 273 1.63e-8 SMART
Pfam:MoaC 493 628 6.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173362
SMART Domains Protein: ENSMUSP00000134265
Gene: ENSMUSG00000064120

DomainStartEndE-ValueType
Pfam:Fer4_12 67 197 5.8e-11 PFAM
Pfam:Radical_SAM 74 199 2.5e-22 PFAM
Pfam:Fer4_14 75 180 2.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173430
Predicted Effect probably benign
Transcript: ENSMUST00000174647
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (53/54)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation lack the cofactor molybdopterin and enzyme activities dependent on the cofactor (including sulfate oxidase and xanthine oxidase), have curly whiskers, and die between postnatal days 1 and 11. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,660,174 I1278N possibly damaging Het
Adcy5 T A 16: 35,267,215 L482Q probably damaging Het
Adora2a A G 10: 75,326,311 I95V probably damaging Het
Anapc1 A C 2: 128,615,430 C1887G probably damaging Het
Arfgef2 T A 2: 166,851,945 probably null Het
Capn11 G T 17: 45,638,696 S448* probably null Het
Capn7 C T 14: 31,336,685 probably benign Het
Cep55 T A 19: 38,060,091 V65D possibly damaging Het
Col5a1 A G 2: 27,928,084 K107R unknown Het
Dbh T A 2: 27,165,610 I32N possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dzip3 A T 16: 48,982,126 N13K probably benign Het
Emilin1 A G 5: 30,917,078 N221S probably benign Het
Ext2 A G 2: 93,739,657 F470L probably damaging Het
Fam71f1 T A 6: 29,323,810 L178H probably damaging Het
Filip1 T A 9: 79,853,634 Q206L probably damaging Het
Gpr63 G T 4: 25,007,320 A15S probably benign Het
Grhl3 T C 4: 135,549,240 probably null Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Ift172 G T 5: 31,275,894 Y193* probably null Het
Ints1 A C 5: 139,758,471 L1512* probably null Het
Kat2b A G 17: 53,663,569 Q661R probably benign Het
Kat6a A G 8: 22,938,538 N1303S possibly damaging Het
L3mbtl4 G T 17: 68,461,566 R223L probably benign Het
Maml2 T C 9: 13,620,881 probably benign Het
Mixl1 A G 1: 180,696,618 probably null Het
Ms4a15 T G 19: 10,984,872 N36T probably damaging Het
Msr1 G A 8: 39,642,616 T2I possibly damaging Het
Nlgn1 A C 3: 25,436,035 Y509* probably null Het
Nsmce1 C A 7: 125,491,434 G4C probably benign Het
Olfr1218 A T 2: 89,055,146 F93L probably damaging Het
Olfr621-ps1 A G 7: 103,629,711 V83A probably damaging Het
Pan3 G A 5: 147,546,365 G452D probably damaging Het
Pcyox1 G T 6: 86,388,909 P441H probably damaging Het
Phf12 T C 11: 78,013,273 V273A probably damaging Het
Plcd4 A G 1: 74,551,989 E181G possibly damaging Het
Ptgfr A T 3: 151,835,541 I110N possibly damaging Het
Rab40c A C 17: 25,919,484 V8G probably damaging Het
Rasal3 T A 17: 32,396,484 Y460F probably damaging Het
Rhbdf2 A G 11: 116,603,651 probably null Het
Ryr2 T A 13: 11,824,400 N496Y possibly damaging Het
Sacs A T 14: 61,213,002 I4166F probably damaging Het
Sh2d3c T C 2: 32,721,160 M1T probably null Het
Smarca2 C T 19: 26,669,155 S651L possibly damaging Het
Sned1 A T 1: 93,285,818 R1204S possibly damaging Het
Spata31d1b T C 13: 59,712,435 Y41H probably damaging Het
Stab2 C T 10: 86,858,152 C2075Y probably damaging Het
Tcte1 A T 17: 45,533,368 Q90L possibly damaging Het
Tll2 C T 19: 41,086,240 G945S probably damaging Het
Tmbim7 A T 5: 3,670,112 T116S probably benign Het
Tnfrsf19 A T 14: 61,005,218 C72* probably null Het
Usp17le T A 7: 104,768,433 T501S probably benign Het
Wnt5b T A 6: 119,448,256 probably benign Het
Other mutations in Mocs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Mocs1 APN 17 49435264 critical splice donor site probably null
IGL00473:Mocs1 APN 17 49433201 missense probably benign 0.01
IGL01565:Mocs1 APN 17 49452320 missense probably benign 0.00
IGL02822:Mocs1 APN 17 49439569 missense probably damaging 1.00
R0321:Mocs1 UTSW 17 49433258 missense probably damaging 1.00
R1313:Mocs1 UTSW 17 49454269 missense probably benign 0.00
R1313:Mocs1 UTSW 17 49454269 missense probably benign 0.00
R2155:Mocs1 UTSW 17 49454358 missense probably damaging 1.00
R2271:Mocs1 UTSW 17 49449109 missense probably damaging 1.00
R2398:Mocs1 UTSW 17 49452834 missense probably damaging 0.99
R4669:Mocs1 UTSW 17 49454585 missense possibly damaging 0.67
R5566:Mocs1 UTSW 17 49454183 missense possibly damaging 0.92
R5751:Mocs1 UTSW 17 49449738 unclassified probably null
R6061:Mocs1 UTSW 17 49450313 missense probably damaging 1.00
R6157:Mocs1 UTSW 17 49454736 missense probably benign 0.06
R6212:Mocs1 UTSW 17 49435196 missense probably damaging 1.00
R6268:Mocs1 UTSW 17 49435155 missense probably damaging 1.00
R7270:Mocs1 UTSW 17 49449115 missense possibly damaging 0.83
R7395:Mocs1 UTSW 17 49454557 missense possibly damaging 0.56
R7522:Mocs1 UTSW 17 49435264 critical splice donor site probably null
R7872:Mocs1 UTSW 17 49439533 missense probably damaging 1.00
R7955:Mocs1 UTSW 17 49439533 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATGTACATGAGGGGTTTGACAG -3'
(R):5'- AGAGAGGGGTTCTGCCATTC -3'

Sequencing Primer
(F):5'- TGACAGGACGCTTGTGGC -3'
(R):5'- CTGCCATTCTATAGTCTAAAGGCGAG -3'
Posted On2019-05-13