Incidental Mutation 'R7047:Ms4a15'
ID547397
Institutional Source Beutler Lab
Gene Symbol Ms4a15
Ensembl Gene ENSMUSG00000067571
Gene Namemembrane-spanning 4-domains, subfamily A, member 15
SynonymsLOC383468, E530011F12Rik, Gm1286
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7047 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location10978307-10993250 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 10984872 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 36 (N36T)
Ref Sequence ENSEMBL: ENSMUSP00000115600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087923] [ENSMUST00000144485] [ENSMUST00000145110]
Predicted Effect probably benign
Transcript: ENSMUST00000087923
SMART Domains Protein: ENSMUSP00000085234
Gene: ENSMUSG00000067571

DomainStartEndE-ValueType
Pfam:CD20 76 170 1.8e-24 PFAM
transmembrane domain 175 197 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144485
AA Change: N36T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000145110
AA Change: N21T

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117513
Gene: ENSMUSG00000067571
AA Change: N21T

DomainStartEndE-ValueType
Pfam:CD20 86 129 2.2e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,660,174 I1278N possibly damaging Het
Adcy5 T A 16: 35,267,215 L482Q probably damaging Het
Adora2a A G 10: 75,326,311 I95V probably damaging Het
Anapc1 A C 2: 128,615,430 C1887G probably damaging Het
Arfgef2 T A 2: 166,851,945 probably null Het
Capn11 G T 17: 45,638,696 S448* probably null Het
Capn7 C T 14: 31,336,685 probably benign Het
Cep55 T A 19: 38,060,091 V65D possibly damaging Het
Col5a1 A G 2: 27,928,084 K107R unknown Het
Dbh T A 2: 27,165,610 I32N possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dzip3 A T 16: 48,982,126 N13K probably benign Het
Emilin1 A G 5: 30,917,078 N221S probably benign Het
Ext2 A G 2: 93,739,657 F470L probably damaging Het
Fam71f1 T A 6: 29,323,810 L178H probably damaging Het
Filip1 T A 9: 79,853,634 Q206L probably damaging Het
Gpr63 G T 4: 25,007,320 A15S probably benign Het
Grhl3 T C 4: 135,549,240 probably null Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Ift172 G T 5: 31,275,894 Y193* probably null Het
Ints1 A C 5: 139,758,471 L1512* probably null Het
Kat2b A G 17: 53,663,569 Q661R probably benign Het
Kat6a A G 8: 22,938,538 N1303S possibly damaging Het
L3mbtl4 G T 17: 68,461,566 R223L probably benign Het
Maml2 T C 9: 13,620,881 probably benign Het
Mixl1 A G 1: 180,696,618 probably null Het
Mocs1 T C 17: 49,452,859 probably null Het
Msr1 G A 8: 39,642,616 T2I possibly damaging Het
Nlgn1 A C 3: 25,436,035 Y509* probably null Het
Nsmce1 C A 7: 125,491,434 G4C probably benign Het
Olfr1218 A T 2: 89,055,146 F93L probably damaging Het
Olfr621-ps1 A G 7: 103,629,711 V83A probably damaging Het
Pan3 G A 5: 147,546,365 G452D probably damaging Het
Pcyox1 G T 6: 86,388,909 P441H probably damaging Het
Phf12 T C 11: 78,013,273 V273A probably damaging Het
Plcd4 A G 1: 74,551,989 E181G possibly damaging Het
Ptgfr A T 3: 151,835,541 I110N possibly damaging Het
Rab40c A C 17: 25,919,484 V8G probably damaging Het
Rasal3 T A 17: 32,396,484 Y460F probably damaging Het
Rhbdf2 A G 11: 116,603,651 probably null Het
Ryr2 T A 13: 11,824,400 N496Y possibly damaging Het
Sacs A T 14: 61,213,002 I4166F probably damaging Het
Sh2d3c T C 2: 32,721,160 M1T probably null Het
Smarca2 C T 19: 26,669,155 S651L possibly damaging Het
Sned1 A T 1: 93,285,818 R1204S possibly damaging Het
Spata31d1b T C 13: 59,712,435 Y41H probably damaging Het
Stab2 C T 10: 86,858,152 C2075Y probably damaging Het
Tcte1 A T 17: 45,533,368 Q90L possibly damaging Het
Tll2 C T 19: 41,086,240 G945S probably damaging Het
Tmbim7 A T 5: 3,670,112 T116S probably benign Het
Tnfrsf19 A T 14: 61,005,218 C72* probably null Het
Usp17le T A 7: 104,768,433 T501S probably benign Het
Wnt5b T A 6: 119,448,256 probably benign Het
Other mutations in Ms4a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0137:Ms4a15 UTSW 19 10979333 unclassified probably benign
R0335:Ms4a15 UTSW 19 10980210 missense probably damaging 1.00
R0494:Ms4a15 UTSW 19 10981358 unclassified probably benign
R0967:Ms4a15 UTSW 19 10979321 missense probably damaging 1.00
R1906:Ms4a15 UTSW 19 10983280 missense probably benign 0.02
R2258:Ms4a15 UTSW 19 10984795 missense probably benign 0.02
R4835:Ms4a15 UTSW 19 10979226 missense possibly damaging 0.90
R6468:Ms4a15 UTSW 19 10993170 missense probably benign
R7978:Ms4a15 UTSW 19 10979330 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCTCCGGTCAAGAACGTCTC -3'
(R):5'- CTAAGAACCCACTTCGTTTCTGTAG -3'

Sequencing Primer
(F):5'- ACGTCTCCATTGGTCTAAGATCAGG -3'
(R):5'- TCTCTAACCCCAGCTGTAGC -3'
Posted On2019-05-13